Gene putatively regulated by attenuation in C_tetani_E88

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:91 nt.    Distance to gene:114 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-10.30 kcal/mol
Antiterminator:    Distance from promoter:39 nt. Size=57 nt.     Delta G= -9.50 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgttt-tataat. It has a score value of 78.31 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgtttttaaaaagaaatatggtataatgattatgaagttatggttaatattttaacaaagtaaaacttattgctaaatagtacgtatatattccctcaa
atatatatgatttagaagaaatagcctagtgaatttaacaaggctattttttgtgcaaaattttaacaactttaaaattgttaactggaatgcttgcata
aatttagaagatatattatagttaataataagtattaattaataataaataaaagtaggtgaaattATG

    CTC01181


Gene: CTC01181     GI: 28210873     BI number: CTC01181     GOG: COG1393     Description: arsenate reductas



 ct
c  c
c  a
 ta
 ta
 at
 ta
 at
 ta
 at
 ta
 gt
 cg
a  |
t  |
g  |
a  |
 ta         t
 at       a  t
 at       a  t
 at       g  a
 ta        ta
 cg        gc
|  a      a  a
|  a       ta
|  g       cg
g  a       cg
 ta        gc
 ta        at
 at        ta
 ta        at
 tg        at
            ttttgtgcaaaattttaacaactttaaaattgttaactggaatgcttgcataaatttagaagatatattatagttaataataagtattaattaataataaataaaagtaggtgaaattATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[P] COG1393 Arsenate reductase and related proteins, glutaredoxin family ... can be seen here

    ..................................................................................................................