                                                                        Gene putatively regulated by attenuation in C_tetani_E88

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:67 nt.    Distance to gene:69 nt.     Distance to run of Ts=0 nt.   Size=38 nt.     Delta G=-14.60 kcal/mol
Antiterminator:    Distance from promoter:36 nt. Size=45 nt.     Delta G= -4.50 kcal/mol
Anti-antiterminator:   Size=69 nt.     Delta G= -6.75 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: tggaca-tataat. It has a score value of 82.33 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tggacaatctctaataaattagatataattagatagtagtttagggtatttatgaaattttaaaatgaagtagaggaatttaaaaattaaaaatgaattg
tgatatttcacttaaaatgttgaaatatcacagtttttttctattgattagctaaaaagtgggataaaacattagataataaagattataatatacaagg
gggcgtattATG

    CTC01190 Gene: CTC01190     GI: 28210880     BI number: CTC01190     GOG: COG0733     Description: sodium-dependent amino acid transporter (proline, tryptophan gt a  a tg at gt at ta tg a  g a  | tg at ta at gt at ta |  t |  g        t |  a      t  a |  a      a  a |  a      a  a        a |  t      a  a      a  a |  t      a  a      t  a |  t       at       t  t |  t       tg        cg |  a       ta        at |  a       ta       |  t |  a       at        cg t  a       at        ta a  t      g  g       ta a  g      g  t       ta a  a      a  g       at t  a      g  a       ta a  g       at        at at        ta        gc ta        gt        ta cg        at        gc ta        at        ta cg        gc        tg tg        ta        at                         ttttttctattgattagctaaaaagtgggataaaacattagataataaagattataatatacaagggggcgtattATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG0733 Na+-dependent transporters of the SNF family ... can be seen here     ..................................................................................................................