                                                                        Gene putatively regulated by attenuation in C_tetani_E88

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:0 nt.     Distance to run of Ts=0 nt.   Size=36 nt.     Delta G=-14.10 kcal/mol
Antiterminator: Size=58 nt.     Delta G= -3.53 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AAATCAAATATCAGCATCTATTGAACAAGTAAATGTAGCTATACGAAATGTTTCAGAC
ACAGCAGAGGAATCGGCAGCAGGATCTAAAGAAATAATGGCAGGAGCTAATGAGACAG
CTATAGCAATGGAAGAGGTATCAACTTCTACAGAAACACAATCTGAATTAGCAAGTAA
ACTTAATAATGTAATTAGTAAATTTAAAATATAAtatttatgtattgaataaagaaaaggtaaagtatattataa
aatgtgtagtattaaaatagtaaagtttaaaaactttactattttaattttATG

    CTC01212 Gene: CTC01212     GI: 28210900     BI number: CTC01212     GOG: COG0583     Description: transcriptional regulatory protei   t g  a g  a a  a a  g a  t a  a g  t a  a at at ta at        aa a  a      t  a g  a       ta ta        ta ta        gc at        at tg        at g  t       at t  g       ta at        gc ta        at t  |       ta tg        at at        at ta        at At        at At        ta Ta        ta             ttttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [K] COG0583 Transcriptional regulator ... can be seen here     ..................................................................................................................