Gene putatively regulated by attenuation in C_tetani_E88

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:227 nt.    Distance to gene:0 nt.     Distance to run of Ts=2 nt.   Size=26 nt.     Delta G=-11.60 kcal/mol
Antiterminator:    Distance from promoter:161 nt. Size=73 nt.     Delta G=-12.50 kcal/mol
Anti-antiterminator:    Distance from promoter:120 nt.    Size=71 nt.     Delta G=-15.80 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGTTA-TATTTT. It has a score value of 60.91 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGTTAAAACTGGAATAATACTATTTTCAACGGTGGTTTTATTTCAACTAATTACTTT
ACCTGTAGAGTTTGACGCTTCATCCAGAGCTATATCAATGCTAGAAGGAACAGGCACA
CTTTACGGTGAAGAGGTAAGAGGTGCAAAAAAGGTCTTAAGTGCTGCGGCTATGACCT
ATGTAGCAGCAACTCTAACGGCTATCTCTCAACTTTTAAGACTTATTGTTTTAAGTAG
AAGAAATGATTAGtaaaaaagctgtatggcacaaatacatgccatacaactttcTTG

    CTC01222 --- CTC01223 --- CTC01224 --- CTC01225 --- CTC01226 --- CTC01227 --- CTC01228


Gene: CTC01222     GI: 28210910     BI number: CTC01222     GOG: COG0144     Description: 16S rRNA M(5)C 967 methyltransferase
Gene: CTC01223     GI: 28210911     BI number: CTC01223     GOG: COG0820     Description: florfenicol resistance protein
Gene: CTC01224     GI: 28210912     BI number: CTC01224     GOG: COG0631     Description: phosphoprotein phosphatase 2C
Gene: CTC01225     GI: 28210913     BI number: CTC01225     GOG: COG0515     Description: serine/threonine protein kinase
Gene: CTC01226     GI: 28210914     BI number: CTC01226     GOG: COG1162     Description: GTPase
Gene: CTC01227     GI: 28210915     BI number: CTC01227     GOG: COG0036     Description: ribulose-phosphate 3-epimerase
Gene: CTC01228     GI: 28210916     BI number: CTC01228     GOG: COG1564     Description: thiamin pyrophosphokinas


 AC
G  C
T  T
A  A
T  T        A
 CG       T  T
 GT       T  T
G  A       CG
 CG        AT
 GC        GT
 TA        AT
 CG        AT
 GC        TA
 TA        TA
|  A       TG
|  C      |  T
|  T       TA
|  C       CG
|  T      A  A
|  A      A  A
|  A       CG
|  C       TA
|  G      |  A
|  G      C  A
|  C      T  T
|  T       CG
|  A       TA
|  T       AT
|  C      |  T
|  T      |  A
|  C      |  G
|  T      |  t
|  C      |  a
|  A      |  a
|  A      |  a       at
|  C      |  a      a  a
|  T      |  a      a  c
 GT        Ta       c  a
 AT        Cg        at
 AT        Gc        cg
 TA        Gt        gc
 TA        Cg        gc
 CG        At        ta
 TA       |  a       at
 GC        At        ta
 GT        Tg        gc
 AT        Cg        ta
                        actttcTTG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[J] COG0144 tRNA and rRNA cytosine-C5-methylases ... can be seen here
[R] COG0820 Predicted Fe-S-cluster redox enzyme ... can be seen here
[T] COG0631 Serine/threonine protein phosphatase ... can be seen here
[RTKL] COG0515 Serine/threonine protein kinase ... can be seen here
[R] COG1162 Predicted GTPases ... can be seen here
[G] COG0036 Pentose-5-phosphate-3-epimerase ... can be seen here
[H] COG1564 Thiamine pyrophosphokinase ... can be seen here

    ..................................................................................................................