                                                                        Gene putatively regulated by attenuation in C_tetani_E88

This operon is putativelly rgulated by Cobalamin_riboswitch

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:42 nt.     Distance to run of Ts=2 nt.   Size=32 nt.     Delta G=-20.30 kcal/mol
Antiterminator: Size=36 nt.     Delta G= -7.90 kcal/mol
Anti-antiterminator:   Size=22 nt.     Delta G= -7.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttatagcttaatagggaagcaggtgaaaatcctgaacggtcccgccgctgtgatggggagttttttcaaagtaaaccactggataatatatctgggaagg
tatgaaaaaataatgaacctaagtcagaatacctacctaaattaaatacactataactctacgagagatgggggtgtttacaggtgattattcatttgtg
taaaatggatttttaaccctcttggcagctcaatgtcaggagggttcctatttttttaaacaatataattaaaaataaaattaagttagaggtgtaatat
ATG

    CTC01372 --- fecD_lrep_3 --- fepC_lrep_2 Gene: CTC01372     GI: 28211051     BI number: CTC01372     GOG: COG0614     Description: ferrichrome-binding periplasmic protein Gene: fecD_lrep_3     GI: 28211050     BI number: CTC00784     GOG: COG0609     Description: iron(III) dicitrate transport system permease protein fecD Gene: fepC_lrep_2     GI: 28211049     BI number: CTC00783     GOG: COG1120     Description: ferric enterobactin transport ATP-binding protein fep             g           t  t           g  a            ta        tc            ta       c  a            ta       g  a            at        at            cg        cg ta        tg        gt t  t       ta        gc at        at        ta gc       t  t       tg ta       t  t       cg gt        at        ta gt        gt        cg at       |  a       cg cg        ta        cg at        gc        at tg        gc        at                         cctatttttttaaacaatataattaaaaataaaattaagttagaggtgtaatatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG0614 ABC-type Fe3+-hydroxamate transport system, periplasmic component ... can be seen here [P] COG0609 ABC-type Fe3+-siderophore transport system, permease component ... can be seen here [PH] COG1120 ABC-type cobalamin/Fe3+-siderophores transport systems, ATPase components ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Cobalamin_riboswitch sequence ... can be seen here     ..................................................................................................................