                                                                        Gene putatively regulated by attenuation in C_tetani_E88

This operon is putativelly rgulated by Cobalamin_riboswitch

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:100 nt.    Distance to gene:4 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-12.70 kcal/mol
Antiterminator:    Distance from promoter:51 nt. Size=61 nt.     Delta G=-11.12 kcal/mol
Anti-antiterminator:    Distance from promoter:17 nt.    Size=47 nt.     Delta G=-14.00 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttaata-tatgtt. It has a score value of 62.92 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttaatatgggaaggctttgtactatgttgatttttaagtcagaagacctgcctgttgttatagatcatactctacggatgataggagggggtttattttt
gtatataattaattcaatttcatgaaaaatcctttttatctattagacgatgaaaaggattttttactATG

    CTC01379 --- CTC01378 --- CTC01377 --- CTC01376 --- CTC01375 Gene: CTC01379     GI: 28211058     BI number: CTC01379     GOG: COG0747     Description: periplasmic transport protein, nickel or dipeptide transport Gene: CTC01378     GI: 28211057     BI number: CTC01378     GOG: COG0601     Description: putative permease, nickel or dipeptide transport Gene: CTC01377     GI: 28211056     BI number: CTC01377     GOG: COG1173     Description: putative permease, nickel or dipeptide transport Gene: CTC01376     GI: 28211055     BI number: CTC01376     GOG: COG0444     Description: putative oligopeptide ABC transporter Gene: CTC01375     GI: 28211054     BI number: CTC01375     GOG: COG4608     Description: putative oligopeptide ABC transporte             a           a  t           t  t           a  a           t  a           a  t           t  t            gc at        ta c  a       ta t  c      |  t at       |  t gc       t  t at       t  c ta        ta |  c       at a  g       tg tg        ta        ta ta        ta       t  g g  t      |  a      a  a t  g      |  a      t  c ta       g  a       cg gt        gt        ta ta        gc        at cg        gc        tg cg        gt        ta |  a       at        ta |  g       gt        ta g  g       gt        ta tg        at        cg cg        ta        cg cg        at        ta at        gc        at                         tttttactATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0747 ABC-type dipeptide transport system, periplasmic component ... can be seen here [EP] COG0601 ABC-type dipeptide/oligopeptide/nickel transport systems, permease components ... can be seen here [EP] COG1173 ABC-type dipeptide/oligopeptide/nickel transport systems, permease components ... can be seen here [EP] COG0444 ABC-type dipeptide/oligopeptide/nickel transport system, ATPase component ... can be seen here [E] COG4608 ABC-type oligopeptide transport system, ATPase component ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Cobalamin_riboswitch sequence ... can be seen here     ..................................................................................................................