                                                                        Gene putatively regulated by attenuation in C_tetani_E88

This operon is putativelly rgulated by Cobalamin_riboswitch

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:25 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-10.50 kcal/mol
Antiterminator: Size=61 nt.     Delta G=-16.10 kcal/mol
Anti-antiterminator:   Size=53 nt.     Delta G= -6.63 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

atgaatttttatggtgtaatttcacattacgtaaaagggaagcttggtgtaaatccagcacggtcccgccactgtaagagagagtatatcattatatgcc
actgttgtttatcaatgggaaggcaatgatgtactatgatctcaagtcaggagacctaccataaaaacttatacaatttgctcacgcggatgaggaggtg
tctatttttattgataagtataatgtttattaatcagtagagctatcttctctttatggagaagatttttttattttaaaaataaacttggaggttttct
ATG

    CTC01400 --- CTC01401 --- CTC01402 --- oppD --- CTC01404 --- CTC01405 Gene: CTC01400     GI: 28211078     BI number: CTC01400     GOG: COG0747     Description: periplasmic dipeptide transport protein precursor Gene: CTC01401     GI: 28211079     BI number: CTC01401     GOG: COG0601     Description: transport system permease, nickel or dipeptide Gene: CTC01402     GI: 28211080     BI number: CTC01402     GOG: COG1173     Description: transport system permease, dipeptide or nickel Gene: oppD     GI: 28211081     BI number: CTC01403     GOG: COG0444     Description: oligopeptide transport ATP-binding protein oppD Gene: CTC01404     GI: 28211082     BI number: CTC01404     GOG: COG4608     Description: peptide transport ATP-binding protein Gene: CTC01405     GI: 28211083     BI number: CTC01405     GOG: COG0500     Description: hypothetical protei             t cg       a  g g  g      a  t c  a      t  t at        at cg        ta ta        gt cg        at g  g      a  a ta        ta tg        at tg        gc at        ta |  g       tg |  t       at |  c       ta |  t       tg |  a       ta        ta |  t       tg       t  t |  t      t  c       tg |  t      a  |       cg |  t      t  |       ta |  t      c  |       cg |  a      t  |       ta a  t       gt        ta c  t       ta        cg a  g       gt        ta ta        gc        at at        at       t  t ta        gt       c  t ta        gc        gt cg        at        at at        gc        gt                         tattttaaaaataaacttggaggttttctATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0747 ABC-type dipeptide transport system, periplasmic component ... can be seen here [EP] COG0601 ABC-type dipeptide/oligopeptide/nickel transport systems, permease components ... can be seen here [EP] COG1173 ABC-type dipeptide/oligopeptide/nickel transport systems, permease components ... can be seen here [EP] COG0444 ABC-type dipeptide/oligopeptide/nickel transport system, ATPase component ... can be seen here [E] COG4608 ABC-type oligopeptide transport system, ATPase component ... can be seen here [QR] COG0500 SAM-dependent methyltransferases ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Cobalamin_riboswitch sequence ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_tetani_E88 This operon is putativelly rgulated by Cobalamin_riboswitch                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:32 nt.     Distance to run of Ts=0 nt.   Size=18 nt.     Delta G= -7.20 kcal/mol Antiterminator: Size=61 nt.     Delta G=-16.10 kcal/mol Anti-antiterminator:   Size=33 nt.     Delta G= -5.80 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case atgaatttttatggtgtaatttcacattacgtaaaagggaagcttggtgtaaatccagcacggtcccgccactgtaagagagagtatatcattatatgcc actgttgtttatcaatgggaaggcaatgatgtactatgatctcaagtcaggagacctaccataaaaacttatacaatttgctcacgcggatgaggaggtg tctatttttattgataagtataatgtttattaatcagtagagctatcttctctttatggagaagatttttttattttaaaaataaacttggaggttttct ATG     CTC01400 --- CTC01401 --- CTC01402 --- oppD --- CTC01404 --- CTC01405 Gene: CTC01400     GI: 28211078     BI number: CTC01400     GOG: COG0747     Description: periplasmic dipeptide transport protein precursor Gene: CTC01401     GI: 28211079     BI number: CTC01401     GOG: COG0601     Description: transport system permease, nickel or dipeptide Gene: CTC01402     GI: 28211080     BI number: CTC01402     GOG: COG1173     Description: transport system permease, dipeptide or nickel Gene: oppD     GI: 28211081     BI number: CTC01403     GOG: COG0444     Description: oligopeptide transport ATP-binding protein oppD Gene: CTC01404     GI: 28211082     BI number: CTC01404     GOG: COG4608     Description: peptide transport ATP-binding protein Gene: CTC01405     GI: 28211083     BI number: CTC01405     GOG: COG0500     Description: hypothetical protei             g           a  a           t  g           g  c            at            ca            tt            ac           a  t            tt            tc            at            tc            tt            tt            gt   t        ta a  g       at a  t       a t  t      t at       a  | ta       t  | gt       g  | at       a  | a  a       a        ta ta        t       t  t at        a        tg gc        g        cg ta        t        ta tg        t        cg at        a        ta ta        t        ta tg        t        cg                         atttttttattttaaaaataaacttggaggttttctATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG0747 ABC-type dipeptide transport system, periplasmic component ... can be seen here [EP] COG0601 ABC-type dipeptide/oligopeptide/nickel transport systems, permease components ... can be seen here [EP] COG1173 ABC-type dipeptide/oligopeptide/nickel transport systems, permease components ... can be seen here [EP] COG0444 ABC-type dipeptide/oligopeptide/nickel transport system, ATPase component ... can be seen here [E] COG4608 ABC-type oligopeptide transport system, ATPase component ... can be seen here [QR] COG0500 SAM-dependent methyltransferases ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Cobalamin_riboswitch sequence ... can be seen here     ..................................................................................................................