                                                                        Gene putatively regulated by attenuation in C_tetani_E88

This operon is putativelly rgulated by Thiamine_Thi-box

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:157 nt.    Distance to gene:21 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-14.90 kcal/mol
Antiterminator:    Distance from promoter:138 nt. Size=32 nt.     Delta G= -7.50 kcal/mol
Anti-antiterminator:    Distance from promoter:107 nt.    Size=44 nt.     Delta G=-13.10 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgact-tatcat. It has a score value of 83.67 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgactgttaaaacatgctgtagtatcatttaattaataatggaataaagtttcaggggagctggtttatgtcagctgagagtaagaactaaattcttag
accctttaacctgatctggataatgccagcgtagggagatggtttactatataattttatattatatagttgtactatttgaatgcaaaagtgcagactt
acgttgtctgtacttttatttttttataaaaatataggaggattttATG

    CTC01754 --- CTC01753 --- CTC01752 --- CTC01751 Gene: CTC01754     GI: 28211404     BI number: CTC01754     GOG: COG4732     Description: conserved protein Gene: CTC01753     GI: 28211403     BI number: CTC01753     GOG: COG0351     Description: phosphomethylpyrimidine kinase Gene: CTC01752     GI: 28211402     BI number: CTC01752     GOG: COG2145     Description: hydroxyethylthiazole kinase Gene: CTC01751     GI: 28211401     BI number: CTC01751     GOG: COG0352     Description: thiamin-phosphate pyrophosphorylas   t t  a t  t ta at at ta        at at       a  g        c ta        gc       a  g at        ta       t  t ta        ta       t  t cg        ta        cg at       a  |       at |  t       ta        gc t  g       cg        at t  t       at        cg ta        tg        gt gc        gc        ta gt        ta        gc ta       |  g       at at        ta        at gt        gc        at at        at        at                         atttttttataaaaatataggaggattttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG4732 Predicted membrane protein ... can be seen here [H] COG0351 Hydroxymethylpyrimidine/phosphomethylpyrimidine kinase ... can be seen here [H] COG2145 Hydroxyethylthiazole kinase, sugar kinase family ... can be seen here [H] COG0352 Thiamine monophosphate synthase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Thiamine_Thi-box sequence ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_tetani_E88 This operon is putativelly rgulated by Thiamine_Thi-box                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:160 nt.    Distance to gene:28 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G=-12.20 kcal/mol Antiterminator:    Distance from promoter:123 nt. Size=32 nt.     Delta G= -7.50 kcal/mol Anti-antiterminator:    Distance from promoter:116 nt.    Size=25 nt.     Delta G= -7.10 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: ttgact-tatcat. It has a score value of 83.67 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ttgactgttaaaacatgctgtagtatcatttaattaataatggaataaagtttcaggggagctggtttatgtcagctgagagtaagaactaaattcttag accctttaacctgatctggataatgccagcgtagggagatggtttactatataattttatattatatagttgtactatttgaatgcaaaagtgcagactt acgttgtctgtacttttatttttttataaaaatataggaggattttATG     CTC01754 --- CTC01753 --- CTC01752 --- CTC01751 Gene: CTC01754     GI: 28211404     BI number: CTC01754     GOG: COG4732     Description: conserved protein Gene: CTC01753     GI: 28211403     BI number: CTC01753     GOG: COG0351     Description: phosphomethylpyrimidine kinase Gene: CTC01752     GI: 28211402     BI number: CTC01752     GOG: COG2145     Description: hydroxyethylthiazole kinase Gene: CTC01751     GI: 28211401     BI number: CTC01751     GOG: COG0352     Description: thiamin-phosphate pyrophosphorylas            ag           t  t            at            tg   t        at         c t  a       ta       a  g t  t      t  |      t  t ta        ac       t  t at        tt        cg at        aa        at ta        tt        gc at        tt        at ta        tt        cg at       |  g       gt ta        ta        ta cg        aa        gc at        at        at                         tttatttttttataaaaatataggaggattttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG4732 Predicted membrane protein ... can be seen here [H] COG0351 Hydroxymethylpyrimidine/phosphomethylpyrimidine kinase ... can be seen here [H] COG2145 Hydroxyethylthiazole kinase, sugar kinase family ... can be seen here [H] COG0352 Thiamine monophosphate synthase ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Thiamine_Thi-box sequence ... can be seen here     ..................................................................................................................