                                                                        Gene putatively regulated by attenuation in C_tetani_E88

This operon is putativelly rgulated by Glycine_cleavage

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:173 nt.    Distance to gene:43 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-18.60 kcal/mol
Antiterminator:    Distance from promoter:144 nt. Size=45 nt.     Delta G=-22.60 kcal/mol
Anti-antiterminator:    Distance from promoter:123 nt.    Size=43 nt.     Delta G=-19.90 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgtaa-tattct. It has a score value of 62.92 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgtaaacatttaaataaaaatgtattctagttgaagagtataagagagatcctattttaaaggacgccgaagggacaatctatgtttatcccaataaaa
catagagaaattctcaggcaaaagaattatactttgatagactctggaaagtaaacagagagagagcgaacgtggggtttgttctctctttattttttta
acagagaggacaaaccttggggtttgttctctttttatttttaatcagattgatatgacaatattttagaagggagattcttttATG

    CTC01813 Gene: CTC01813     GI: 28211456     BI number: CTC01813     GOG: COG0697     Description: transporte            tt   g       t  t t  g      t  t g  g       at cg        ta at        ta at       |  c gt        ta        tg cg        cg       t  g gt        ta        cg at        cg        cg gc        ta        at at        cg        at gc        tg        at at        ta        cg gc        gc        at at        ta        gt gt        ta        gc at        ta        at c  a       gc        gc at        gc        at at        gt        gt at        gt        at                         ttatttttaatcagattgatatgacaatattttagaagggagattcttttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [GER] COG0697 Permeases of the drug/metabolite transporter (DMT) superfamily ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Glycine_cleavage sequence ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_tetani_E88 This operon is putativelly rgulated by Glycine_cleavage                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:177 nt.    Distance to gene:50 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G=-12.20 kcal/mol Antiterminator:    Distance from promoter:141 nt. Size=45 nt.     Delta G=-22.60 kcal/mol Anti-antiterminator:    Distance from promoter:127 nt.    Size=35 nt.     Delta G=-19.80 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: ttgtaa-tattct. It has a score value of 62.92 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ttgtaaacatttaaataaaaatgtattctagttgaagagtataagagagatcctattttaaaggacgccgaagggacaatctatgtttatcccaataaaa catagagaaattctcaggcaaaagaattatactttgatagactctggaaagtaaacagagagagagcgaacgtggggtttgttctctctttattttttta acagagaggacaaaccttggggtttgttctctttttatttttaatcagattgatatgacaatattttagaagggagattcttttATG     CTC01813 Gene: CTC01813     GI: 28211456     BI number: CTC01813     GOG: COG0697     Description: transporte            at           t  t           t  t            tt            ct   g        tt t  g      |  t g  g       ca cg        ta at        cc at        ta gt        tg        tg cg        ga       t  g gt        tg        cg at        ta        cg gc        tg        at at        gg        at gc        ga        at at        gc        cg gc        ga        at at        ta        gt gt        ga        gc at        cc        at                         ctttttatttttaatcagattgatatgacaatattttagaagggagattcttttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [GER] COG0697 Permeases of the drug/metabolite transporter (DMT) superfamily ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Glycine_cleavage sequence ... can be seen here     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_tetani_E88 This operon is putativelly rgulated by Glycine_cleavage                                                                         Characteristics of the secondary structures Terminator:    Distance from promoter:127 nt.    Distance to gene:86 nt.     Distance to run of Ts=0 nt.   Size=35 nt.     Delta G=-19.80 kcal/mol Antiterminator:    Distance from promoter:100 nt. Size=45 nt.     Delta G= -7.30 kcal/mol Anti-antiterminator:    Distance from promoter:62 nt.    Size=56 nt.     Delta G= -4.59 kcal/mol                                                                         Nomenclature/Definitions The most likely promoter is: ttgtaa-tattct. It has a score value of 62.92 and is shown in blue Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ttgtaaacatttaaataaaaatgtattctagttgaagagtataagagagatcctattttaaaggacgccgaagggacaatctatgtttatcccaataaaa catagagaaattctcaggcaaaagaattatactttgatagactctggaaagtaaacagagagagagcgaacgtggggtttgttctctctttattttttta acagagaggacaaaccttggggtttgttctctttttatttttaatcagattgatatgacaatattttagaagggagattcttttATG     CTC01813 Gene: CTC01813     GI: 28211456     BI number: CTC01813     GOG: COG0697     Description: transporte gc g  a a  a c  a ta cg         g ta       a  t ta       a  a at       a  a at       g  a |  a       gc |  t       ta         g a  a       cg       t  g gc        ta       g  g at        cg        cg gt       |  a       at at       a  g       at tg       g  a       gt a  a      a  g       cg c  t      t  a       gt a  a      a  g       at a  g       gc        gc a  a       tg        at a  c       ta        gc t  t       ta        at a  c      |  c       gc at        cg        at cg        at        gt cg        tg        at                         atttttttaacagagaggacaaaccttggggtttgttctctttttatttttaatcagattgatatgacaatattttagaagggagattcttttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [GER] COG0697 Permeases of the drug/metabolite transporter (DMT) superfamily ... can be seen here                                                                         Genes that have a predicted attenuator with a riboswitch: Glycine_cleavage sequence ... can be seen here     ..................................................................................................................