Gene putatively regulated by attenuation in C_diphtheriae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:111 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G= -8.90 kcal/mol
Antiterminator: Size=45 nt.     Delta G=-16.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

aaaataattcgaaaaatgacgcggtcgaataaaaaaatttttctcggattcttgcacctagggtcggctgcacgcgtgctgatcgcttacaaatctttaa
aacactcttgaaatgagaatgattatccgtatggtgtgtggtgtccggccggacgaaccacagagccttagaccaaaaggctgtgtttttccattcaatc
gataccgatctttctatttgagaggggaatctctttgtctcgtagcaagaacgcactaattcgaaatctttcgattgccgcaggagcggcagcaataagc
GTG

    DIP0013


Gene: DIP0013     GI: 38232655     BI number: DIP0013     GOG: -------     Description: Hypothetical protei



 gc
g  c
 cg
 cg
 ta
 gc
|  g
|  a
 ta
 gc
 gc
 ta
 gc         c
 ta       a  c
|  g      g  a
g  a      a  a
 tg        ta
 gc        ta
 gc        cg
|  t       cg
|  t       gc
t  a       at
a  g      g  g
 ta        at
 gc        cg
            tttttccattcaatcgataccgatctttctatttgagaggggaatctctttgtctcgtagcaagaacgcactaattcgaaatctttcgattgccgcaggagcggcagcaataagcGTG


    ..................................................................................................................