                                                                        Gene putatively regulated by attenuation in C_diphtheriae

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:57 nt.    Distance to gene:19 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-22.30 kcal/mol
Antiterminator:    Distance from promoter:25 nt. Size=41 nt.     Delta G=-12.20 kcal/mol
Anti-antiterminator:    Distance from promoter:25 nt.    Size=23 nt.     Delta G= -6.70 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: ttgcct-taactt. It has a score value of 64.93 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttgcctaacttttgataagtcactaacttaattaaatagaactgaacctcagtaagcattggctcgtttccaatgttgattgctccgccggtgctcctta
tttttaagggcgccggctttcttaatagaaaggcgtaaagGTG

    DIP0036 --- DIP0037 --- DIP0038 Gene: DIP0036     GI: 38232678     BI number: DIP0036     GOG: -------     Description: Conserved hypothetical protein Gene: DIP0037     GI: 38232679     BI number: DIP0037     GOG: COG1518     Description: Conserved hypothetical protein Gene: DIP0038     GI: 38232680     BI number: DIP0038     GOG: COG3512     Description: Conserved hypothetical protei            tt           g  g            ta            at            at            cg           c  c       tt           t  t      t  t           t  c       at           t  c       ta   g       g  |       ta c  t      c  |       cg t  t      t  |       cg c  t       cg       t  | gc        gc        cg gc        gc        gc ta        tg        tg ta        tg        gc at        at        gc cg        cg        cg gt        gc        cg at        at        gc                         tttcttaatagaaaggcgtaaagGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [L] COG1518 Uncharacterized protein predicted to be involved in DNA repair ... can be seen here [S] COG3512 Uncharacterized protein conserved in bacteria ... can be seen here     ..................................................................................................................