Gene putatively regulated by attenuation in C_diphtheriae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:70 nt.     Distance to run of Ts=1 nt.   Size=36 nt.     Delta G=-13.50 kcal/mol
Antiterminator: Size=31 nt.     Delta G=-19.40 kcal/mol
Anti-antiterminator:   Size=51 nt.     Delta G=-20.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

gcagcgcccggcggggaatcttcatcaaatcttcaaacatcacccttcgaccgccatcacccttgtgccccaccccgggccggcggcatcgcctccccta
gtcggttcagcaggcgccaccagggatttcactgcctgtaccgcatacccggggcgggtagaaggacatcgcccacggctgtggagtggtgtcccggtgg
tgacccagcccaccgaactcacccctttttcgccctgttataaggctgtgagcagggtttttgatttctactccgtcaggcacccgtgcaagatacaggt
ATG

    DIP0066


Gene: DIP0066     GI: 38232700     BI number: DIP0066     GOG: NOG06665     Description: Putative exported protei


 ta
a  c
c  c
 gc
 cg
 cg
a  g
t  g
 gc                   c
 tg                 c  c
 cg                 a  a
 cg        gc       g  g
 gt       g  t      t  c
 ta        cg        gc
 cg        at        gc
|  a       cg        ta
|  a       cg        gc
a  g      |  a       gc
 cg        cg        cg
 ta        gt       |  a
t  c       cg       c  a
 ta        tg       c  c
 at        at       t  t
 gc        cg        gc
|  g       at        ta
 gc        gc        gc
 gc        gc        gc
                        cctttttcgccctgttataaggctgtgagcagggtttttgatttctactccgtcaggcacccgtgcaagatacaggtATG


    ..................................................................................................................