                                                                        Gene putatively regulated by attenuation in C_diphtheriae

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:57 nt.    Distance to gene:91 nt.     Distance to run of Ts=0 nt.   Size=38 nt.     Delta G=-28.90 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGACC-AACTTT. It has a score value of 61.58 and is shown in blue

TTGACCTCGGTAGCAGCTTTGAAACTTTGGTGGTTGACCTAGGTTCGTGAaccgctcacaaag
agcagttcacgaactgcaacggccggaggtcacaaactcgaaagagggagtgacctccggtttcttctttttctgatttttggggccgaggatgggttaa
gtagcgggttaagtagcaaaaatgcccgcatccccgtatgcacttttagtgaaccTTG

    DIP0081 --- DIP0082 Gene: DIP0081     GI: 38232713     BI number: DIP0081     GOG: -------     Description: Hypothetical protein Gene: DIP0082     GI: 38232714     BI number: DIP0082     GOG: -------     Description: Putative secreted protei           aa          g  a           cg           ta           cg          a  g          a  g          a  a           cg           at           cg           ta           gc           gc           at           gc           gc           cg           cg             tttcttctttttctgatttttggggccgaggatgggttaagtagcgggttaagtagcaaaaatgcccgcatccccgtatgcacttttagtgaaccTTG     ..................................................................................................................