                                                                        Gene putatively regulated by attenuation in C_diphtheriae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:173 nt.     Distance to run of Ts=3 nt.   Size=34 nt.     Delta G=-16.50 kcal/mol
Antiterminator: Size=45 nt.     Delta G=-17.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGCGCTCCGGCGCGCAGTGTAGACGGTGTGCGCGGATATGGCGCACTTGGCTGGATAG
GCGTTGCTGCCATGGTGATCTATGGCGTGGTGGCACCCCTGTTTGGTGTTACCTGCGT
GGCGTTTTTGATCTGCAGCATGCTGAAGAAGTGAagtgagtagttcgtgccaaaactttttgaggctcgcagcgt
ttccgcaggtcggagatataagaaaagatgcaatttggcacgaactactcactcgcaatcatcacggcagttattacacaatcctcgtagtgccctagac
tgtgttcacATG

    DIP0125 --- DIP0126 --- DIP0127 Gene: DIP0125     GI: 38232753     BI number: DIP0125     GOG: COG1611     Description: Conserved hypothetical protein Gene: DIP0126     GI: 38232754     BI number: DIP0126     GOG: COG4805     Description: Conserved hypothetical protein Gene: DIP0127     GI: 38232755     BI number: DIP0127     GOG: COG1846     Description: Putative MarR-family regulatory protei GA T  T GC GT TA AT CG CG         G GC       T  T |  G      C  T |  T      C  T TG        CG CG        CG G  T       AT T  G       CG TG        GT GC        GT C  A       TA GC        GC GC        GC A  |      |  T T  |       TG A  |       GC GC        CG GC        GT             GGCGTTTTTGATCTGCAGCATGCTGAAGAAGTGAagtgagtagttcgtgccaaaactttttgaggctcgcagcgtttccgcaggtcggagatataagaaaagatgcaatttggcacgaactactcactcgcaatcatcacggcagttattacacaatcctcgtagtgccctagactgtgttcacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [R] COG1611 Predicted Rossmann fold nucleotide-binding protein ... can be seen here [S] COG4805 Uncharacterized protein conserved in bacteria ... can be seen here [K] COG1846 Transcriptional regulators ... can be seen here     ..................................................................................................................