Gene putatively regulated by attenuation in C_diphtheriae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:173 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-18.80 kcal/mol
Antiterminator: Size=42 nt.     Delta G=-11.90 kcal/mol
Anti-antiterminator:   Size=20 nt.     Delta G= -6.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

caacaacaagctGCGCCCGTAGCTCAACGGATAGAGCATCTGACTACGGATCAGAAGGTTGGG
GGTTCGAATCCCTCCGGGCGCAcaagtgaaaccccagctcatagcatgtttgagctggggtttcttcatgatgtgtgggttgtc
tgactgttggctgttgttgcaggtggttggtgctcgtaccgaacgcataccgaacataggccgaacagaaaccgaacaagagtcgaacgggcaccgaacg
gggtaattcccatagatcagtttctgcgtcccttgtaggtaagatgatcacttATG

    DIP0179


Gene: DIP0180     GI: 38232805     BI number: DIP0180     GOG: -------     Description: Hypothetical protei


            C
          T  C
           CG
           CG
           CG
          |  C
          |  G
          |  C
          |  A
          |  c        a
          T  a      c  t
          A  a      g  g
          A  g      a  t
           Gt       t  t
 GA        Cg        at
C  A       Ta        cg
T  T       Ta        ta
T  C      G  a       cg
 GC        Gc        gc
 GC        Gc        at
 GT        Gc        cg
 GC        Gc        cg
 GC        Ta        cg
 TG        Tg        cg
                        tttcttcatgatgtgtgggttgtctgactgttggctgttgttgcaggtggttggtgctcgtaccgaacgcataccgaacataggccgaacagaaaccgaacaagagtcgaacgggcaccgaacggggtaattcccatagatcagtttctgcgtcccttgtaggtaagatgatcacttATG


    ..................................................................................................................