                                                                        Gene putatively regulated by attenuation in C_diphtheriae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:148 nt.     Distance to run of Ts=1 nt.   Size=27 nt.     Delta G= -6.90 kcal/mol
Antiterminator: Size=43 nt.     Delta G=-12.10 kcal/mol
Anti-antiterminator:   Size=32 nt.     Delta G=-10.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCTCAACTCCCGGCGCGGAGCGGCAGGCTGATGAGTGGGCAGCACAGCAGCTTTTGGA
TGTTGGTGATGTGGAGGCTGTAGGGCTTGAGTGTGAGGGTTCTGCTGCGGCGATGGCT
GCAGAGTTGGGTGTTACACCTCATCTACTCGTTTTGTGGATGGGGATGTATGAGCGAG
GAAGGATTCAGCCGGAGAAGAGGGCATGTTAAtgccttaatcactttctcatatgtaacaatcggtgtgatatttt
cgatattttgttaaaatatcactcgaactgttataagaaaggaatatggcATG

    DIP0184 --- DIP0183 Gene: DIP0184     GI: 38232809     BI number: DIP0184     GOG: -------     Description: Hypothetical protein Gene: DIP0183     GI: 38232808     BI number: DIP0183     GOG: COG2856     Description: Putative transcriptional regulato            AT           G  G            CG            GC            GT            CG            GC TG        TA G  T       CG A  G      |  A       CA G  A      |  G      A  C TG       G  T      T  C TG       T  T      T  T CG        CG        GC GT        TG        TA GT        TG        GT GC       G  T       GC AT       G  G       GT TG       G  |      T  | GC        AT        TA T  T       GT        GC CG        TA        AT GC        GC        GC                         GTTTTGTGGATGGGGATGTATGAGCGAGGAAGGATTCAGCCGGAGAAGAGGGCATGTTAAtgccttaatcactttctcatatgtaacaatcggtgtgatattttcgatattttgttaaaatatcactcgaactgttataagaaaggaatatggcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG2856 Predicted Zn peptidase ... can be seen here     ..................................................................................................................