                                                                        Gene putatively regulated by attenuation in C_diphtheriae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:7 nt.     Distance to run of Ts=0 nt.   Size=32 nt.     Delta G=-24.50 kcal/mol
Antiterminator: Size=16 nt.     Delta G= -6.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGGATACGCGCCATGCGAAGTCCTGCCCCTAGCCTAACGGAACCCCCACCGCGGAGCA
ATTCCACCACCACCCACTCCCCATCTTCCTGCGGATTTGCTTGATCCACGGAAGCGTG
TGTATTGTTTGCGAAGTAACACGGCATgcccgtgcatacgctGGAGGATTCGACTAGCGGCCTA
TGTCACACGCCTGGAACGCGTGCGGGTTTCACGACCCTCGTGGGTTCAAATCCCACAT
CCTCCGcaaacaccaaccggtgttctctactgagaacgccggttgtttttgttttctggggtTTG

    DIP0255 Gene: DIP0255     GI: 38232878     BI number: DIP0255     GOG: -------     Description: Hypothetical protei            ac           t  t            cg            ta            cg            ta            ta            gc ac        tg a  c       gc cg        gc cg        cg at        cg cg        at at        at at        cg             tttttgttttctggggtTTG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_diphtheriae                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:14 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-21.90 kcal/mol Antiterminator: Size=16 nt.     Delta G= -6.10 kcal/mol Anti-antiterminator:   Size=34 nt.     Delta G=-13.30 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case GGGATACGCGCCATGCGAAGTCCTGCCCCTAGCCTAACGGAACCCCCACCGCGGAGCA ATTCCACCACCACCCACTCCCCATCTTCCTGCGGATTTGCTTGATCCACGGAAGCGTG TGTATTGTTTGCGAAGTAACACGGCATgcccgtgcatacgctGGAGGATTCGACTAGCGGCCTA TGTCACACGCCTGGAACGCGTGCGGGTTTCACGACCCTCGTGGGTTCAAATCCCACAT CCTCCGcaaacaccaaccggtgttctctactgagaacgccggttgtttttgttttctggggtTTG     DIP0255 Gene: DIP0255     GI: 38232878     BI number: DIP0255     GOG: -------     Description: Hypothetical protei CA T  C TG                  ac TA                 t  t GC                  cg GC                  ta GC                  cg C  T                 ta GC                  ta TG        CA        gc GT       T  A       tg CG        TA        gc G  G       GT        gc CG        GC        cg AT        GC        cg AT        TC        at GC        GA        at                         gtttttgttttctggggtTTG     ..................................................................................................................