Gene putatively regulated by attenuation in C_diphtheriae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:157 nt.     Distance to run of Ts=0 nt.   Size=35 nt.     Delta G=-10.14 kcal/mol
Antiterminator: Size=45 nt.     Delta G=-13.00 kcal/mol
Anti-antiterminator:   Size=55 nt.     Delta G=-18.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGGCGCCGGCGATTGAAGCTGCCTTGCGTACCGGTGTGGCGACCCATGTGGTGATTGA
TCATGCTACGGCGCAGCGCGTGGTAGAGATGGCGTAGtgaagatgtggcgctgttaatgcggtcgaatactag
tgccatttttatttccccctgtgtttgattggctgattttgagtgtagtcatagtgctataacatgcgctagcccctactgctacccctttttgttcgaa
tgctctttcggatgtcaagtccctgcgatacactcgcaaccaccatgaacaaccagggggctacacatcATG

    DIP0268


Gene: DIP0268     GI: 38232891     BI number: DIP0268     GOG: -------     Description: Conserved hypothetical protei


 GA
T  T
T  C
A  A       GA
G  T      A  G
 TG        TA
 GC        GT
 GT       G  G
 TA        TG
 GC        GC
T  |       CG
A  |       GT
C  |      |  A       gg
 CG       |  G      c  t
 CG       |  t      g  c
A  |      |  g      t  g
 GC       |  a      a  a
 CG       |  a      a  a
 GC       |  g      t  t
G  A      |  a       ta
 TG       |  t       gc
 GC        Cg       |  t
 TG        Gt        ta
 GC       A  g       cg
|  G       Cg        gt
 GT        Gc        cg
 CG        Cg        gc
 CG        Gc        gc
 AT        Gt        ta
 TA        Cg        gt
                        ttttatttccccctgtgtttgattggctgattttgagtgtagtcatagtgctataacatgcgctagcccctactgctacccctttttgttcgaatgctctttcggatgtcaagtccctgcgatacactcgcaaccaccatgaacaaccagggggctacacatcATG


    ..................................................................................................................