                                                                        Gene putatively regulated by attenuation in C_diphtheriae

                                                                        Characteristics of the secondary structures
Terminator:    Distance from promoter:85 nt.    Distance to gene:34 nt.     Distance to run of Ts=0 nt.   Size=27 nt.     Delta G=-21.70 kcal/mol
Antiterminator:    Distance from promoter:69 nt. Size=32 nt.     Delta G=-11.10 kcal/mol
Anti-antiterminator:    Distance from promoter:34 nt.    Size=42 nt.     Delta G=-12.50 kcal/mol

                                                                        Nomenclature/Definitions
The most likely promoter is: TTGGTC-TATTTT. It has a score value of 60.24 and is shown in blue
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TTGGTCTTTACGGTTTTGATTCTGGTTATTTTCCAGGTGATCTGGCGCGAGGAGAAGA
AGTTGATGCAGGAGCGTGCTTTGAAGCTCGAGCAGGGTGTTTAGttcctgactaggagaagcgctgg
ggaggaattccccagcgcttttgttatcgttgagcgtggacgcgaaggagaaccataGTG

    DIP0284 --- DIP0283 --- DIP0282 Gene: DIP0284     GI: 38232905     BI number: DIP0284     GOG: COG1840     Description: Putative ABC-transport system iron-binding secreted protein Gene: DIP0283     GI: 38232904     BI number: DIP0283     GOG: -------     Description: Putative transport system permease (iron) Gene: DIP0282     GI: 38232903     BI number: DIP0282     GOG: -------     Description: Putative ABC transport system ATP-binding protei   T C  C G  G A  A A  G GC TA TG        aa TG       g  g CG       a  c        a GT       g  g      g  a TG        gc        gt |  T       at        at |  T       tg        gc |  T       cg        gc G  A      a  g       gc CG       g  g       gc Gt        ta        ta At        cg        cg Gc        cg        gc Gc        ta        cg At        ta        gc Cg        Gt        at                         tttgttatcgttgagcgtggacgcgaaggagaaccataGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG1840 ABC-type Fe3+ transport system, periplasmic component ... can be seen here     ..................................................................................................................