                                                                        Gene putatively regulated by attenuation in C_diphtheriae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:133 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G= -9.50 kcal/mol
Antiterminator: Size=32 nt.     Delta G= -8.80 kcal/mol
Anti-antiterminator:   Size=49 nt.     Delta G= -5.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTTGCCGTTTCGTGGACGCGGTGTGCTCCGCATGTCTACTAACGACGGCGCCTCTTGG
CAGCACAATCGCGTGTTTAATCCTCGACACTACGTGTATCAGTGCATGACCCAGCTTC
CCGACGGTTCCATCGGTCTATTGTGGGAACGCGAAATGCAGGGACTGTTTTTCAGCAT
CATTCCCATGACATGGATCATGCAAGGCTATGCCCTTTAAaaaggtcacaattttcttttcaaatattct
gcacatacgctaataaagttcattgcttttcctcgttccgagagaggatcctcgtcGTG

    DIP0329 Gene: DIP0329     GI: 38232950     BI number: DIP0329     GOG: COG1297     Description: opt family protein. Putative membrane protei CA T  G AT TG GC TA GT CG                  GA |  A                G  A |  C        T        GC |  C      A  C       TG A  C       CG        GC TA        CG        TG CG       |  T       TA |  C      |  C      |  A |  T      T  T      |  A A  T       TA       |  T C  C       GT       |  G A  C       GT       |  C GC        CG       |  A CG        AT       A  G TA       G  |       TG C  C       CG        CG CG        CG        TA TG        CG        GC AT        TA        GT AT        TA        CG                         TTTTTCAGCATCATTCCCATGACATGGATCATGCAAGGCTATGCCCTTTAAaaaggtcacaattttcttttcaaatattctgcacatacgctaataaagttcattgcttttcctcgttccgagagaggatcctcgtcGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG1297 Predicted membrane protein ... can be seen here     ..................................................................................................................