Gene putatively regulated by attenuation in C_diphtheriae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:28 nt.     Distance to run of Ts=0 nt.   Size=36 nt.     Delta G=-22.90 kcal/mol

                                                                        Nomenclature/Definitions

CCATCTTTGCTACCAACCTGATTACCGCTACTGAGGGTGGCATCATCGAGGCTGGCAC
CAACATGTGCACCCACGACCTCAAGGTGAAGATGGATTCGCTGAACATCCCAGCTACC
TTCAACTTCCGTAACACTGGCACCCACTCGTGGGGCTACTGGGAAGAGGACATGGTTG
CCTCGTGGGAGCTGTTCAACATGGCTTTTAACAAGTAAatctcttcgctttacttcctcgctgatacgcttt
gggtgcgttatcagcgaggttttttattacccccaaggaaaggacacgccggcgATG

    DIP0364 --- DIP0363 --- rmlB --- DIP0361 --- rfbA


Gene: DIP0364     GI: 38232980     BI number: DIP0364     GOG: COG1505     Description: Putative prolyl oligopeptidase family protein
Gene: DIP0363     GI: 38232979     BI number: DIP0363     GOG: COG0308     Description: Putative metallopeptidase
Gene: rmlB     GI: 38232978     BI number: DIP0362     GOG: COG1088     Description: Putative dTDP-(glucose or rhamnose)-4,6-dehydratase
Gene: DIP0361     GI: 38232977     BI number: DIP0361     GOG: COG1091     Description: Putative bifunctional protein
Gene: rfbA     GI: 38232976     BI number: DIP0360     GOG: COG1209     Description: glucose-1-phosphate thymidylyltransferas


           g
         t  g
         t  g
         t  t
          cg
          gc
          cg
         |  t
          at
          ta
          at
          gc
          ta
          cg
          gc
          cg
          ta
          cg
          cg
            ttttttattacccccaaggaaaggacacgccggcgATG


                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[E] COG1505 Serine proteases of the peptidase family S9A ... can be seen here
[E] COG0308 Aminopeptidase N ... can be seen here
[M] COG1088 dTDP-D-glucose 4,6-dehydratase ... can be seen here
[M] COG1091 dTDP-4-dehydrorhamnose reductase ... can be seen here
[M] COG1209 dTDP-glucose pyrophosphorylase ... can be seen here

    ..................................................................................................................