                                                                        Gene putatively regulated by attenuation in C_diphtheriae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:128 nt.     Distance to run of Ts=0 nt.   Size=37 nt.     Delta G=-10.30 kcal/mol
Antiterminator: Size=49 nt.     Delta G= -9.70 kcal/mol
Anti-antiterminator:   Size=38 nt.     Delta G= -5.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tcacactaagagggtcgtctaaagatcacccattcgtatgacaccgaaagggtggggagcggggatggtgtacaaaatcactaaaaagttggatgatcgt
tccctgtcgcctcacgcttttggaaaagtgccggtagatgtggcaatttttagccaccccagaagccgtttttaggtcagggtaccctaaactgcaggta
gaatgatgtttttaggtaggtgacctaattcacaatgggtgtttgtaagtggtctataggcgagttcgggtcgtaaaattatagcgacactggaggtgcc
ATG

    DIP0370 --- DIP0371 --- DIP0372 Gene: DIP0370     GI: 38232986     BI number: DIP0370     GOG: NOG13320     Description: Putative succinate dehydrogenease cytochrome B subunit Gene: DIP0371     GI: 38232987     BI number: DIP0371     GOG: COG1053     Description: Putative succinate dehydrogenase Gene: DIP0372     GI: 38232988     BI number: DIP0372     GOG: COG0479     Description: Putative succinate dehydrogenase iron-sulfur protei            gg           t  a            ta            ta            ta tc        cg t  c       gt        tt g  c       cg       t  t c  t      a  c      a  t tg       c  c      a  a at       t  |       cg gc        cg        gc tg        cg        gc a  |       gt        ta gc       |  a       gc gc        cg       |  c |  t       ta       |  c |  c       gt       |  c |  a       tg       t  a t  c      c  t      a  g tg        cg       g  a gc        cg       a  a at       |  c       tg at        ta        gc at        ta        gc at        gt        cg                         tttttaggtcagggtaccctaaactgcaggtagaatgatgtttttaggtaggtgacctaattcacaatgggtgtttgtaagtggtctataggcgagttcgggtcgtaaaattatagcgacactggaggtgccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG1053 Succinate dehydrogenase/fumarate reductase, flavoprotein subunit ... can be seen here [C] COG0479 Succinate dehydrogenase/fumarate reductase, Fe-S protein subunit ... can be seen here     ..................................................................................................................