                                                                        Gene putatively regulated by attenuation in C_diphtheriae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:31 nt.     Distance to run of Ts=1 nt.   Size=28 nt.     Delta G=-23.30 kcal/mol
Antiterminator: Size=49 nt.     Delta G= -5.54 kcal/mol
Anti-antiterminator:   Size=39 nt.     Delta G= -8.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

accgagatgaaggcaaagcgcgacgagaacaacgccaacgctggcctttaccacgcaaacatcaacgtcctcgaccagaagaccctcgaggatgccatgg
agaaccctgacaagtacccgaacctcaccgttcgtgtttccggctacgccgtcaactttgtcaagctcacccgtgagcagcagctggacgttctttcccg
tacgttccaccactctgcgtaagatgtaacgccaccacctgcctgtacacgggcaggtggtatatttttgccctaatgaagcgaaaggaatccctctgat
ATG

    DIP0379 --- DIP0378 Gene: DIP0379     GI: 38232995     BI number: DIP0379     GOG: COG1180     Description: Putative oxidoreductase Gene: DIP0378     GI: 38232994     BI number: DIP0378     GOG: -------     Description: Putative secreted protei            at           g  g           a  t tc       a  a t  c       ta t  c       gc c  g       cg t  t       gc ta       t  c gc       c  a cg       t  c |  t      c  c       ac at       a  a      t  a gc       c  c       gc gc       c  c       tg ta        at        cg |  c       cg        cg |  c      c  c       gc |  a      t  c       ta |  c      t  |       cg c  t       gt        cg gc        cg        at at        at        cg cg        ta        cg gc        gc        at                         atatttttgccctaatgaagcgaaaggaatccctctgatATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [O] COG1180 Pyruvate-formate lyase-activating enzyme ... can be seen here     ..................................................................................................................