                                                                        Gene putatively regulated by attenuation in C_diphtheriae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:28 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-23.10 kcal/mol
Antiterminator: Size=29 nt.     Delta G= -9.80 kcal/mol
Anti-antiterminator:   Size=47 nt.     Delta G=-15.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCATTCGTGTCAGAATCGAGCCCCAACCTGCGGGCGGATGTGCACTTCGGCCGCGCGA
AAGACCGTGGGGCTTCTGACAGGGAAGTACGTACACCAATCTACGAAGCGAGGGAAAC
CGTTATGGGTTCTGTCATCAAGAAGCGCCGCAAGCGCATGTCCAAGAAGAAGCACCGC
AAGTTGCTGCGCCGCACCCGTGTTCAGCGTAGAAAACTCGGTAAGTAAgcctcttggctctttt
ccgcccaaggaatgttatttccttgggcggttttgtattctgcgataagcgtttaggaaaggATG

    DIP0397 Gene: DIP0397     GI: 38233011     BI number: DIP0397     GOG: -------     Description: Putative secreted protei CC C  G AT CG GT |  T |  C C  A CG GC CG GT        ct        tt TA       t  t      g  a CG        cg       t  t |  A       cg        at G  A       gc        at TA        At        gc TA       A  c       gc GC       T  t       at AT        Gt        at A  |       At        cg C  |       At        cg GC       T  |       cg CG        Gc        gc CG        Gc        cg AT        Cg        cg                         ttttgtattctgcgataagcgtttaggaaaggATG     ..................................................................................................................