                                                                        Gene putatively regulated by attenuation in C_diphtheriae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:95 nt.     Distance to run of Ts=0 nt.   Size=38 nt.     Delta G=-12.40 kcal/mol
Antiterminator: Size=47 nt.     Delta G= -7.20 kcal/mol
Anti-antiterminator:   Size=21 nt.     Delta G= -3.90 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGCAGCTCAGATACGTCCGGTGGTGGCTGCTGCTGGTGCGGAGCTTGTGATCGTCGAT
GTGGATTCGGATTCGGCGTTGGCCTCGGAGTTTGGTGATCGAGTGCCGGTGGTGGTGA
TCGACGATGAGGAATTTTCTTGTTGGGAAGTGGATAATGAGGAATTGGCTGCGGAGCT
GGCTCAATAGcgggagttagccaaggctttgttgtgcaattggtcactataggccagagtgtttaatgatcaatcattcttatggttgatatt
gtggtgagggtaagcgagcggaaaggtgagcgcGTG

    DIP0400 --- hemC Gene: DIP0400     GI: 38233014     BI number: DIP0400     GOG: COG0373     Description: Putative glutamyl-tRNA reductase Gene: hemC     GI: 38233015     BI number: DIP0401     GOG: COG0181     Description: Porphobilinogen deaminas             G           A  G           G  A            TA            AT            AT            TG           A  G       AG            GC       T  c            GT       A  g            TG       A  g            GC        Cg           |  G       Ta           |  G       Cg           |  A       Gt           |  G       Gt   T       |  C       Ta A  T      |  T       Cg AT       A  G       Gc GT       A  G      A  c GC        GC       G  a AT        GT       G  a G  T       GC       C  | T  G       TA       G  | AT        TA        Tg GT        GT        Cg CG        TA        Gc                         tttgttgtgcaattggtcactataggccagagtgtttaatgatcaatcattcttatggttgatattgtggtgagggtaagcgagcggaaaggtgagcgcGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG0373 Glutamyl-tRNA reductase ... can be seen here [H] COG0181 Porphobilinogen deaminase ... can be seen here     ..................................................................................................................