Gene putatively regulated by attenuation in C_diphtheriae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:170 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-16.10 kcal/mol
Antiterminator: Size=34 nt.     Delta G=-12.10 kcal/mol
Anti-antiterminator:   Size=35 nt.     Delta G=-10.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GATGATGAGGGCCCAGGCCACGATGAGTGCGAGTAAGGCTTTCCACCATACGATTCCG
GCCCCGGCTGCACCGGTTCCCACGATGACGGGCGCGAAGGCGTTTGCCCAAGTGTGTG
GGCGAGCTCCTTCTTTCCAATCGGCAAAGGTTGCTTGAGACATgttgtctattcttccattgcgtttc
ttgtgtggttaatttatagttggatagtagcgaacaaaggttcgaacacgcaagtgggggtaaatgttaggggcgggtgctatggtgcctgtatatattg
attttaagggggaaatATG

    DIP0419


Gene: DIP0419     GI: 38233033     BI number: DIP0419     GOG: -------     Description: Conserved hypothetical protei


  C
T  C
T  C       AA
G  A      G  G
 GC        CG
 CG        GC        TG
C  A       CG       G  T
 AT        GT       A  G
 CG        GT        AT
G  A       GT        CG
T  |       CG        CG
C  |      |  C       CG
G  |      A  C       GC
 GC        GC        TG
 CG        TA        TA
 CG       A  A       TG
 CG       G  |       GC
|  C       CG       C  T
 CG        AT        GC
 GC        CG        GC
                        TTCTTTCCAATCGGCAAAGGTTGCTTGAGACATgttgtctattcttccattgcgtttcttgtgtggttaatttatagttggatagtagcgaacaaaggttcgaacacgcaagtgggggtaaatgttaggggcgggtgctatggtgcctgtatatattgattttaagggggaaatATG
    ..................................................................................................................