Gene putatively regulated by attenuation in C_diphtheriae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:149 nt.     Distance to run of Ts=2 nt.   Size=33 nt.     Delta G= -8.80 kcal/mol
Antiterminator: Size=36 nt.     Delta G= -9.60 kcal/mol
Anti-antiterminator:   Size=18 nt.     Delta G= -6.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CCTATATTTTGCTTCCCGACGTTTTTGTAGCTATTGAGGTGGGTGAAACAATTGGATG
GTTTGACCCCGCATATTGGAGCCGTGAGGAGTTCCTGGAGGAAGCCATACTCGCTTAA
cctgcataaccgcgtgcacgcgaggatatttttatagtcccttcaccctcaatgcctgcgccgttgctctagccaacgtaggtcaccaagtctacttaag
tacaccaccgtggggcgccacaaggagattgacaatctcatggctcgtaaaatctacaagcaaatcggaatggaacagtaggacATG

    DIP0455


Gene: DIP0455     GI: 38233067     BI number: DIP0455     GOG: -------     Description: Conserved hypothetical protei


           GG        cc
          T  A      a  g
           CG       a  c
           CG        tg
           TA        at
           TA        cg
          G  G       gc
          A  |       ta
           GC       c  c
 TG        GC       c  |
G  A      A  A      A  |
 CG        GT       A  |
 CG        TA       T  |
|  A       GC       T  |
|  G      |  T       Cg
G  T      C  C       Gc
 AT        CG        Cg
 GC        GC        Ta
 GC        AT        Cg
                        gatatttttatagtcccttcaccctcaatgcctgcgccgttgctctagccaacgtaggtcaccaagtctacttaagtacaccaccgtggggcgccacaaggagattgacaatctcatggctcgtaaaatctacaagcaaatcggaatggaacagtaggacATG


    ..................................................................................................................