                                                                        Gene putatively regulated by attenuation in C_diphtheriae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:120 nt.     Distance to run of Ts=1 nt.   Size=30 nt.     Delta G= -8.10 kcal/mol
Antiterminator: Size=42 nt.     Delta G= -4.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGCTCGGGCGACGAGGCATTCTCGCCGTGGATAGGAGGGTGACTCATaatgcgctttcttggaaa
tgtccgcttgtgcacggtgtttattggcatacaaacgtattgcgcacaatgtggagataaaagaatacgagggattaagtaggggatcatccggtagcgg
atctcgctagttatttaatcatgattttgtcggtctaaaaattggagatgtgcttcagggctgtgatatataccttaagtgaggtctcttacataggtgg
tggatatatgtggcaagcgatgataatggaagctcATG

    DIP0503 Gene: DIP0503     GI: 38233115     BI number: DIP0503     GOG: -------     Description: Putative molybdenum cofactor biosynthesis protei ga g  t g  t a  a g  a cg at        ta ta       g  g a  g       gc a  g       cg g  g       cg a  g       ta a  |      a  | a  |      c  | a  |      t  | ta        at at        gc gc        gt |  a       gc at       |  g gc        gc gc        at tg        ta             gttatttaatcatgattttgtcggtctaaaaattggagatgtgcttcagggctgtgatatataccttaagtgaggtctcttacataggtggtggatatatgtggcaagcgatgataatggaagctcATG     ..................................................................................................................