                                                                        Gene putatively regulated by attenuation in C_diphtheriae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:113 nt.     Distance to run of Ts=1 nt.   Size=36 nt.     Delta G=-21.60 kcal/mol
Antiterminator: Size=27 nt.     Delta G= -8.76 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ACTTCAAGCCGATCTCCCTGACCGGCCTGAGCTTCTCGGGTGTTGGCACCACTCAGTA
Gcactcaatcttccccctagctcccaatctttttccacacatcgcctagagcgggtcctagggggaatcccgccaccttttatctctttgccggtggcat
aaatagcacagccaccggcaaacatttttcgtccagcaagcgctgaataagatattccaaccccctcaattggttgcacgcaatgtacgtggttcagcgg
ttttagctgtagataacagttccgatagtcaggattacgcacATG

    DIP0514 --- DIP0513 --- DIP0512 --- DIP0511 Gene: DIP0514     GI: 38233123     BI number: DIP0514     GOG: -------     Description: Putative oligopeptide transport system integral membrane protein Gene: DIP0513     GI: 38233122     BI number: DIP0513     GOG: COG0444     Description: Putative oligopeptide transport system (integral membrane and ATP-binding proteins) Gene: DIP0512     GI: 38233121     BI number: DIP0512     GOG: COG4608     Description: Putative oligopeptide transport system ATP-binding protein Gene: DIP0511     GI: 38233120     BI number: DIP0511     GOG: -------     Description: Putative lysine biosynthesis protei            ta           a  g           a  c           a  a   t       t  c c  c      a  a t  t       cg a  t       gc t  t       gc t  g       ta t  c       gc t  c       gc cg        cg cg        cg at        gc cg        ta cg        ta gc        ta             catttttcgtccagcaagcgctgaataagatattccaaccccctcaattggttgcacgcaatgtacgtggttcagcggttttagctgtagataacagttccgatagtcaggattacgcacATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [EP] COG0444 ABC-type dipeptide/oligopeptide/nickel transport system, ATPase component ... can be seen here [E] COG4608 ABC-type oligopeptide transport system, ATPase component ... can be seen here     ..................................................................................................................