                                                                        Gene putatively regulated by attenuation in C_diphtheriae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:123 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G=-22.90 kcal/mol
Antiterminator: Size=60 nt.     Delta G=-23.90 kcal/mol
Anti-antiterminator:   Size=48 nt.     Delta G=-13.04 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCAACCTGTCAAGGTTCTTGGTAACGGCGAGATCAGCGTCAAGCTGAACGTCACTGCA
ACCAAGTTCTCCAAGTCTGCAGTTGAGAAGATCGAAGCCGCTGGCGGCTCCGTGACCG
AGGCTTAAttttaagcttcaccgagctggtagttactcataatgggtaactaccagcttttctgttatataaacatcgtgcctacatgtgtcag
gggtaacagaattaaagaaatgtaacctgcgacctttattatcgaagggttggtttaaccccgctatcgctatgagaggtaaacaccctaGTG

    DIP0530 Gene: DIP0530     GI: 38233139     BI number: DIP0530     GOG: COG2116     Description: Putative transport protei            tt           A  t            At            Ta            Ta            Cg TG        Gc C  G       Gt GC       A  | CG       G  | CG       C  | GC       C  | AT        At A  C       Gc GC        Ta CG        Gc         a |  T      C  c      t  a |  G       Cg       a  t |  A       Ta        cg |  C       Cg        tg T  C       Gc        cg A  G       Gt        at G  A       Cg        ta A  G      G  g       ta A  G       Gt        gc GC        Ta        at AT        Cg        ta GT        Gt        gc TA       C  t       gc TA       C  a       ta Gt        Gc        cg At        At        gc                         ttttctgttatataaacatcgtgcctacatgtgtcaggggtaacagaattaaagaaatgtaacctgcgacctttattatcgaagggttggtttaaccccgctatcgctatgagaggtaaacaccctaGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [P] COG2116 Formate/nitrite family of transporters ... can be seen here     ..................................................................................................................