                                                                        Gene putatively regulated by attenuation in C_diphtheriae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:20 nt.     Distance to run of Ts=0 nt.   Size=25 nt.     Delta G= -9.30 kcal/mol
Antiterminator: Size=42 nt.     Delta G= -9.80 kcal/mol
Anti-antiterminator:   Size=18 nt.     Delta G= -5.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CTAGCTAAGGCTCTGTTAATATCCATCGGAAGTAGGGGATGCGGCTGCGCTATATCGT
TGCAGTTCGGGTGCACtcgttgcgctaaaagtgcgattttcaggtagtaaaaatgaaattccagtgcaatgtgtggctcaggtaactc
tataaaaatttgtcggtcttagtcacacaatattaagcttacagcttgaatggtgattaccacctagcttgaaacgtatccgtgctgttcaacggattgg
gctaggggcttttgggtaaaccataagtctttttctaactgtaaaggcggtgtcGTG

    DIP0534 Gene: DIP0534     GI: 38233143     BI number: DIP0534     GOG: COG2182     Description: Putative sugar-binding secreted protei            gg           c  a            at            at            cg            tg            tg            gc           |  t           |  a           |  g           |  g        a            tg       t  a            cg       g  a            gc        gc gt       |  t       gc t  t      |  t       ta c  c      t  t      t  t g  a       gt        ta ta        cg        ta gc        cg        cg cg        tg        gt cg        at        gc ta        ta        gt                         ttttctaactgtaaaggcggtgtcGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [G] COG2182 Maltose-binding periplasmic proteins/domains ... can be seen here     ..................................................................................................................