                                                                        Gene putatively regulated by attenuation in C_diphtheriae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:69 nt.     Distance to run of Ts=0 nt.   Size=38 nt.     Delta G=-23.90 kcal/mol
Antiterminator: Size=34 nt.     Delta G= -6.50 kcal/mol
Anti-antiterminator:   Size=12 nt.     Delta G= -4.00 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTCATGCCGAAAACTGAGCAAGTGAGCTTGGAAGTGTTGCTACACGGCCCATCTACAA
ATGTGTTCGGCGAAGAGAATTTCGTCGGCGGCCTCAAACGTGCGATGGCTAAGTGTGG
CTACACTGACTTGAAGAGCTTCCAAAAAGTGGATCTGACAGTTCAGTTCTAActgccgtta
acggtttgctacaacgcgcacactgccaacatgaggcgggggtgcgcgttttgtttcgattagatatcgatgggggctgaccccattccccagatagtta
gggttgtgttaccttgggaagctATG

    DIP0582 --- DIP0583 --- DIP0584 --- DIP0585 --- DIP0586 --- DIP0587 --- DIP0588 Gene: DIP0582     GI: 38233191     BI number: DIP0582     GOG: -------     Description: Putative iron transport system binding (secreted) protein Gene: DIP0583     GI: 38233192     BI number: DIP0583     GOG: -------     Description: Putative iron transport system membrane protein Gene: DIP0584     GI: 38233193     BI number: DIP0584     GOG: -------     Description: Putative iron transport system membrane protein Gene: DIP0585     GI: 38233194     BI number: DIP0585     GOG: COG1120     Description: Putative iron transport system ATP-binding protein Gene: DIP0586     GI: 38233195     BI number: DIP0586     GOG: COG4264     Description: Putative siderophore biosynthesis related protein Gene: DIP0587     GI: 38233196     BI number: DIP0587     GOG: -------     Description: Putative membrane protein Gene: DIP0588     GI: 38233197     BI number: DIP0588     GOG: -------     Description: Putative membrane protei                       a                     c  t                     a  g            aa       a  a           c  c       cg           a  g       cg           t  c       gc            cg        tg            gc        cg            ta       |  g           t  c      a  g            ta        cg            gc        at            gt        cg ta        cg        gc t  a      a  c       cg gc       a  c       gc cg        ta        cg cg        ta        at gt        gc        at                         ttgtttcgattagatatcgatgggggctgaccccattccccagatagttagggttgtgttaccttgggaagctATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [PH] COG1120 ABC-type cobalamin/Fe3+-siderophores transport systems, ATPase components ... can be seen here [Q] COG4264 Siderophore synthetase component ... can be seen here     ..................................................................................................................