                                                                        Gene putatively regulated by attenuation in C_diphtheriae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:40 nt.     Distance to run of Ts=3 nt.   Size=29 nt.     Delta G= -9.40 kcal/mol
Antiterminator: Size=40 nt.     Delta G=-12.40 kcal/mol
Anti-antiterminator:   Size=38 nt.     Delta G=-12.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGGGATGAAAAGCCACACGGCGACGTAAAAGAGGATGCCGATTCCGTTAACAAAAGAT
AACAGTGCGAGAACCCATCGCACTGTCACAACTTTGACGCCTAGATAGCTGGCGAGTC
CTGCTGCGACACCGGCGACTATGCCGTGGGAGCGGTCGCGGTAATAACGGGGAAAAGC
TGGCTGCATGTGGATTATTGTTGCATGTGCCGTGGCCACGGGCACataggggatgtccctgaatgtt
cagggtttttgttttttaagggtgaagttcagggctatccctgatgtggggagggcgcgGTG

    DIP0598 Gene: DIP0598     GI: 38233205     BI number: DIP0598     GOG: -------     Description: Putative membrane protei AT        CC T  T      G  A TG        GC AT        TG GT       G  | |  G       CG GC        CG         t TA        GC       a  g GT        TA       g  t TG        GC        gc AT        Ta        gc CG        At        gc GC       C  a       at |  C      G  |       tg |  G       Tg       a  a |  T       Tg       C  a TG       G  g       At CG        Tg        Cg GC        Ta        Gt GC        At        Gt TA        Tg        Gc                         agggtttttgttttttaagggtgaagttcagggctatccctgatgtggggagggcgcgGTG     ..................................................................................................................