                                                                        Gene putatively regulated by attenuation in C_diphtheriae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:24 nt.     Distance to run of Ts=1 nt.   Size=16 nt.     Delta G= -6.40 kcal/mol
Antiterminator: Size=34 nt.     Delta G= -3.10 kcal/mol
Anti-antiterminator:   Size=49 nt.     Delta G=-11.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ATTCATGTTGATGTTTCGGAAGGAATCGTCAATTCTGTCCAGCCGTTGCGAGGTCGTA
CTACGCAAAACCAAGATGATTTTGTGGGGTTGTCTCTGCAGTCGTTGGTATAActttctgc
atctgatgttgtttgttagctgtcatggtgtcgtttctgttatcggaagcgacactttgatttttgtcgaaggttttgggggtatgacgtggggttattt
atctcaaccgattgaaagttaaagcaaacctttgtaaggtacgccttgcctttattttcctttaggaaggactatccctctATG

    DIP0629 Gene: DIP0629     GI: 38233236     BI number: DIP0629     GOG: -------     Description: Membrane protei   g t  g g  g cg at gt ta at |  t t  t g  a       ag gt       a  c gc       a  a gt        ta gc        ta ta        gc t  |      a  c t  |       at ta        at gc        gt        ac gc        tg       t  g |  g      t  t       gc a  a      a  a       gc at       g  a       at gt        cg        at cg        cg        tg ta        at        gc                         ctttattttcctttaggaaggactatccctctATG     ..................................................................................................................                                                                         Gene putatively regulated by attenuation in C_diphtheriae                                                                         Characteristics of the secondary structures Terminator:    Distance to gene:116 nt.     Distance to run of Ts=0 nt.   Size=40 nt.     Delta G=-22.90 kcal/mol Antiterminator: Size=33 nt.     Delta G= -8.40 kcal/mol Anti-antiterminator:   Size=37 nt.     Delta G= -7.00 kcal/mol                                                                         Nomenclature/Definitions Bases shared by the antitermination and termination structures are shown in red Bases shared by the anti-antitermination and antitermination structures are shown in green The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined Coding regions are in CAPS, non-coding regions are in lower case ATTCATGTTGATGTTTCGGAAGGAATCGTCAATTCTGTCCAGCCGTTGCGAGGTCGTA CTACGCAAAACCAAGATGATTTTGTGGGGTTGTCTCTGCAGTCGTTGGTATAActttctgc atctgatgttgtttgttagctgtcatggtgtcgtttctgttatcggaagcgacactttgatttttgtcgaaggttttgggggtatgacgtggggttattt atctcaaccgattgaaagttaaagcaaacctttgtaaggtacgccttgcctttattttcctttaggaaggactatccctctATG     DIP0629 Gene: DIP0629     GI: 38233236     BI number: DIP0629     GOG: -------     Description: Membrane protei   T                  ta G  A                t  t GT         t        gc TA       t  g       tg TA       t  t       cg Gc        gt        ta |  t       ta        ta C  t       tg        tg T  t       gc        gc Gc       |  t       cg At        tg        ta Cg        at        gc Gc        gc        ta Ta        ta        gc |  t      |  t       gt C  c       cg       t  t T  t       tg        at Cg        at        cg Ta        cg        ta Gt        gt        gt                         ttttgtcgaaggttttgggggtatgacgtggggttatttatctcaaccgattgaaagttaaagcaaacctttgtaaggtacgccttgcctttattttcctttaggaaggactatccctctATG     ..................................................................................................................