                                                                        Gene putatively regulated by attenuation in C_diphtheriae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:192 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-20.00 kcal/mol
Antiterminator: Size=40 nt.     Delta G= -5.30 kcal/mol
Anti-antiterminator:   Size=44 nt.     Delta G= -7.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CATGCGCCCCGTCGCAGAATTCAATGACATCATCGATGCGCTGAAGTAAggtcgcgctctttta
tagctaaaaaatgggaaggaatcgacgattccttcccattttttatgcccctgccccatattttctctgcgatcaccacaaccaactacccccaaatgcg
caccactttgtctacatttttattcactacctgaactggacttttagaattttatagaccgatcggtttctttttccctgaagtcgccctagcgttgctt
gcaacgaaaacatcttagggaaggaatcgacgattcATG

    DIP0630 Gene: DIP0630     GI: 38233237     BI number: DIP0630     GOG: COG2873,COG0626     Description: Putative methionine biosynthesis-related protei   T A  C CG TA AT CG         a A  |      a  a GC       t  a TG       c  a A  C      g  a AT        at         a CG        tg       g  c TA       a  g       cg TA        tg        ta |  G       ta        at |  T       ta        at |  A       tg        gc |  A       cg        gc |  g       ta        at A  g      c  a       at At       g  t       gc Gc       c  |       gc A  |       gc        gc Cg        cg        ta Gc        ta        at Cg        gc        at                         ttttatgcccctgccccatattttctctgcgatcaccacaaccaactacccccaaatgcgcaccactttgtctacatttttattcactacctgaactggacttttagaattttatagaccgatcggtttctttttccctgaagtcgccctagcgttgcttgcaacgaaaacatcttagggaaggaatcgacgattcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [E] COG2873 O-acetylhomoserine sulfhydrylase ... can be seen here [E] COG0626 Cystathionine beta-lyases/cystathionine gamma-synthases ... can be seen here     ..................................................................................................................