Gene putatively regulated by attenuation in C_diphtheriae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:80 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G= -8.00 kcal/mol
Antiterminator: Size=47 nt.     Delta G=-11.30 kcal/mol
Anti-antiterminator:   Size=20 nt.     Delta G= -4.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttatcgacgttccccatgtccgcactcatcccctagatataaggatgagcttgtagtttgtgtgttgttgattactccttagtgtgttctatcccctagg
agtgagatgtttaatagcatcagctttgaggcgctcactcagtaaaagccggtatgtctagcgtggccgcactgccaagctcctcggatgttgtatcgcg
gtatattcgcgtcctattttgtggctgatttcttatgcgcgaaggcggttgttctttgcagaaggaagattcccacataacaccccgaaaggttcataaa
TTG

    DIP0651


Gene: DIP0651     GI: 38233258     BI number: DIP0651     GOG: NOG10391     Description: Conserved hypothetical protei


           ca
          g  c
          c  t
           cg
           gc
           gc
           ta
          g  a
           cg
           gc
           at
          |  c       gc
          |  c      c  g
          |  t       tg
          |  c       at
           tg        ta
  t        cg        gt
c  a       ta        ta
t  g       gt       |  t
 gc       |  g      |  t
 tg       |  t      |  c
 at       |  t       tg
|  g       tg        gc
 tg        at        tg
 gc        ta        at
 gc        gt        gc
 cg        gc        gc
                        tattttgtggctgatttcttatgcgcgaaggcggttgttctttgcagaaggaagattcccacataacaccccgaaaggttcataaaTTG


    ..................................................................................................................