Gene putatively regulated by attenuation in C_diphtheriae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:3 nt.     Distance to run of Ts=0 nt.   Size=18 nt.     Delta G= -6.00 kcal/mol
Antiterminator: Size=40 nt.     Delta G= -7.96 kcal/mol
Anti-antiterminator:   Size=13 nt.     Delta G= -3.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

AGTCGGATCTCACCGCGTTGGCGGAAGCTGTACGAGAAGCGGGAACACACGCTTCTGG
TTTGGTTGACCCTATTCGTGTAGATACCCCTGTTCCGGAAGATATTGGCGGTAACCAT
CCCATTAATCGCGTCAAGCGTCAGCGTGGGCGGCGTGCGCATCTGAGCGTTGTGCCGG
AACCTGAAGACGATGACGATAACGATTAGggcataaagctggactgcgggcggactcgtatccgtcctagggggtagaa
tccctgtgaatacttttgtgcatccctgaaaggtgggattttctttcATG

    DIP0687


Gene: DIP0687     GI: 38233294     BI number: DIP0687     GOG: COG1109     Description: Putative phosphomannomutas


            g
          t  a
          g  a
          t  t
          c  a
          c  c
          c  t
          t  t
           at
           at
          g  g
           at
           tg        aa
           gc       a  g
  g       |  a      g  g
a  a       gt       t  t
 ta        gc        cg
 gt        gc        cg
 gc        gc        cg
 gc        at        ta
 gc        tg        at
                        tttctttcATG
                                                                        Orthologous genes that have a predicted attenuator, grouped in COG families

[G] COG1109 Phosphomannomutase ... can be seen here

    ..................................................................................................................