                                                                        Gene putatively regulated by attenuation in C_diphtheriae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:170 nt.     Distance to run of Ts=0 nt.   Size=30 nt.     Delta G=-19.90 kcal/mol
Antiterminator: Size=38 nt.     Delta G= -5.70 kcal/mol
Anti-antiterminator:   Size=54 nt.     Delta G= -8.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GGCGGTAGGTGATGCTTTGGATAATTTCTTGGCGTGGTATGACCCTTCGGAATTGTCG
GCTTTGGTGGATCTGCTGTAGatcatcttttttaaggcgcactcttgtcacggttgtggcaggggtgcgtttttgtgttttcgct
gttcggggcatgttcggcatgaggggtagggggtggtctttcttagacagagatacttttctctccaaatgtttgacggaaaaacttacgctgacgtaac
atgcatactcacttcggttacctaaccgtaggttacgtttgggaagggaagaatgtcATG

    DIP0703 --- DIP0704 Gene: DIP0703     GI: 38233310     BI number: DIP0703     GOG: COG1018     Description: Putative oxidoreductase Gene: DIP0704     GI: 38233311     BI number: DIP0704     GOG: -------     Description: Conserved hypothetical protei   T A  T A  G GT GC CG TG |  C |  T T  T       tc C  T      a  t CG       c  t CG       t  t AT        at G  G       Gt T  G       At        gt A  |       Ta       g  t TA       G  a       cg GT        Tg        at GC        Cg        cg T  |       Gc        tg GT        Tg        gc CG       C  |       ta GC       T  |       tg GT       A  |       cg TG       G  |       tg |  T       Gc        cg TA        Ta        at CG        Gc        cg Ta        Gt        gc                         gtttttgtgttttcgctgttcggggcatgttcggcatgaggggtagggggtggtctttcttagacagagatacttttctctccaaatgtttgacggaaaaacttacgctgacgtaacatgcatactcacttcggttacctaaccgtaggttacgtttgggaagggaagaatgtcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [C] COG1018 Flavodoxin reductases (ferredoxin-NADPH reductases) family 1 ... can be seen here     ..................................................................................................................