                                                                        Gene putatively regulated by attenuation in C_diphtheriae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:73 nt.     Distance to run of Ts=0 nt.   Size=33 nt.     Delta G=-22.10 kcal/mol
Antiterminator: Size=20 nt.     Delta G= -4.60 kcal/mol
Anti-antiterminator:   Size=40 nt.     Delta G=-12.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ttaagagacttgctggtttgttgtgtcaacggggcaaactgggactttcaccgatgactgggctcatcatccgggtgtgttcgtccaagccggagagccg
agtagagatccacgcgcgaactgcgcacggagaagccctagcgaggtgacgtaggacccgggttcaattcccggcagctccaccactaggacgctcattt
tgatacaaagtgagcgtcctttttgttttgcccgaacgggtggcgttttaggggttaagggtcaaaaggggatgcggacggaatcttggaggattccatt
ATG

    DIP0752 Gene: DIP0752     GI: 38233358     BI number: DIP0752     GOG: -------     Description: IS element transposas   a c  a t  t t  t gc gc                   t gc                 a  a cg                  gc cg                  ta c  c                 ta a  a                 ta g  |        a        tg g  |      c  c       at a  |      c  t       cg tg       a  a       ta gc        cg        cg c  t       cg        gc a  c       ta        cg gc       |  c       at ta        cg        gc gc        gc        gc gc        at        at                         ttttgttttgcccgaacgggtggcgttttaggggttaagggtcaaaaggggatgcggacggaatcttggaggattccattATG     ..................................................................................................................