Gene putatively regulated by attenuation in C_diphtheriae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:196 nt.     Distance to run of Ts=2 nt.   Size=23 nt.     Delta G= -7.10 kcal/mol
Antiterminator: Size=48 nt.     Delta G= -8.00 kcal/mol
Anti-antiterminator:   Size=25 nt.     Delta G= -4.40 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

atcgaacgtcacacaccacacatggaaccgactatccataccggacaacagcctgcacaggccgtacaccatcccgtcctcatgatcgagaggtggagtt
ttctcggctatctgctcgttcggttcgatgactctaccaaatgagtccttggacagtccctcgaccagtgccgcaatagcatgggcagtattgcgggaaa
gacccagcccacgctgctcgtggtatgtcccccacggtggctgggcggccttgtgaatcaccgtgtccaggatgtgccgtgacgttacgaaagtcatcgg
GTG

    DIP0801


Gene: DIP0801     GI: 38233400     BI number: DIP0801     GOG: -------     Description: Hypothetical protei


           ca
          g  c
           ta
           cg
           cg
           gc
          a  c
           cg
           at
          |  a
          |  c
          |  a
          |  c
          |  c
  a       |  a
a  c      |  t
c  a      |  c
a  g      |  c       at
 gc       a  c      g  c
 gc        cg       t  g
c  |       at       a  a
c  |       gc        cg
a  |       gc        ta
t  |      c  t       cg
 at       c  c       cg
 cg       a  |      t  |
 Gc        ta        gt
 Ta        at        cg
 Gc        cg        cg
                        agttttctcggctatctgctcgttcggttcgatgactctaccaaatgagtccttggacagtccctcgaccagtgccgcaatagcatgggcagtattgcgggaaagacccagcccacgctgctcgtggtatgtcccccacggtggctgggcggccttgtgaatcaccgtgtccaggatgtgccgtgacgttacgaaagtcatcggGTG


    ..................................................................................................................