                                                                        Gene putatively regulated by attenuation in C_diphtheriae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:163 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-17.70 kcal/mol
Antiterminator: Size=74 nt.     Delta G=-18.59 kcal/mol
Anti-antiterminator:   Size=44 nt.     Delta G=-13.30 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CAGACCGTTCGCATCCCACGTCGCCTGGTTAAGGCAGCTCAGCTTGGTCTCGTTGAGG
TTGAGCAGTTCTAAgctcttgtggatataattccactatcaatgaaggctgatttcggttagatcgaagtcagcctttattcatttgtaa
tttagaagacttctttcggagtgtgtgtcggttggctgctattgtcaacattcaacgcactataaaattgttgcattaaatgtaattattcatagctgac
tctgggcgttgcttgagggtcggtctcggcgggacaaggcagaatagactgaATG

    DIP0854 --- DIP0855 Gene: DIP0854     GI: 38233451     BI number: DIP0854     GOG: COG0745     Description: Putative two component system response regulator Gene: DIP0855     GI: 38233452     BI number: DIP0855     GOG: -------     Description: Putative two component system sensor kinas            ta           a  a           t  t            at            gc            gc            ta            gc           t  t           t  a           c  t           t  c           c  a           g  a           A  t           A  |           T  | TC        Cg C  G       Ta T  T       Ta G  T      G  g G  G      A  | TA        Cg TG        Gc CG        At         a GT       G  |      t  g AT        Tg        ta CG        Ta        gt TA        Gt        gc CG        Gt        cg GC        At        ta A  A       Gc        ta CG        Tg        tg GT        Tg        at G  T      G  t       gc A  C      C  t       ta AT        Ta        cg TA        Cg        gc TA        Ta        gc                         tttattcatttgtaatttagaagacttctttcggagtgtgtgtcggttggctgctattgtcaacattcaacgcactataaaattgttgcattaaatgtaattattcatagctgactctgggcgttgcttgagggtcggtctcggcgggacaaggcagaatagactgaATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [TK] COG0745 Response regulators consisting of a CheY-like receiver domain and a winged-helix DNA-binding domain ... can be seen here     ..................................................................................................................