                                                                        Gene putatively regulated by attenuation in C_diphtheriae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:1 nt.     Distance to run of Ts=1 nt.   Size=37 nt.     Delta G=-10.50 kcal/mol
Antiterminator: Size=24 nt.     Delta G= -6.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCATATAAGCGGCGGCGCGTGTGGCATTGATTGTGCGAATGAGGGCGGTCAACTGATT
GAGGATGGCAGCGTTATCGGCATGTAAATCAGCTGTGCTGCGGGCTAATCGAGCAGCT
CGTATGCGATTTCTGGCATTTTTTTTGGCGGCAGTGAGTGTTAAAGCGTCGGACATag
ccaccagcttagagggtgtttatggtcgtttccccacggggaggggtctcagaatgtgacttttaatttcggttttccttggtgccgaaacctatctggg
gcatagttcgcggtactgttttctttATG

    DIP0862 Gene: DIP0862     GI: 38233459     BI number: DIP0862     GOG: COG1210     Description: Putative urydyltransferas             g           g  g           t  g           c  c            ta            at            ta ct        cg c  t      c  t t  g      a  t t  g      a  c t  t      a  g tg        gc gc        cg gc        cg cg        gt ta        ta ta        gc ta        gt             gttttctttATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [M] COG1210 UDP-glucose pyrophosphorylase ... can be seen here     ..................................................................................................................