                                                                        Gene putatively regulated by attenuation in C_diphtheriae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:66 nt.     Distance to run of Ts=0 nt.   Size=23 nt.     Delta G=-17.90 kcal/mol
Antiterminator: Size=48 nt.     Delta G= -5.60 kcal/mol
Anti-antiterminator:   Size=53 nt.     Delta G= -9.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

ACCCTGAAAAAGACAACGAATTTATCCTAGTTGAAGGCTTCAAAGACGGCAGCGATGT
GGCACACGTACAGTCCGAGGCATTCCAGCGTGCCTGCGAAGAAATTCCTCGCTACCTC
CTAGAAACACCAAAGATTATTAACGTCTCCATCCCCGGCAAGACCGAATGGGACACCA
TGGCTGAATTTGTTGTTGAGTAAaaaaattttcggggccgctgtaatggcggcccttttttacgcacaaacagtagtgaagag
cgaaaatttcgcctttcgaattcactcacgttaggagaacaccATG

    DIP0879 --- DIP0880 --- DIP0881 --- DIP0882 Gene: DIP0879     GI: 38233476     BI number: DIP0879     GOG: -------     Description: Putative membrane protein Gene: DIP0880     GI: 38233477     BI number: DIP0880     GOG: -------     Description: Putative RNA polymerase sigma factor (ECF family) Gene: DIP0881     GI: 38233478     BI number: DIP0881     GOG: -------     Description: Hypothetical protein Gene: DIP0882     GI: 38233479     BI number: DIP0882     GOG: COG2326     Description: Putative RNA polymerase sigma facto   A A  G C  A GC GC CG |  A |  A       GA |  T      T  G CG       T  T CG       G  A CG        TA TA        Ta |  C      G  a |  A       Ta |  C       Ta |  C       Ta |  A       At AT        At CG        Gt CG       |  t |  C      |  c        a T  T      |  g      t  a CG       |  g      g  t TA        Tg        tg |  A       Cg        cg |  T       Gc        gc |  T       Gc        cg GT        Tg        cg CG       A  c       gc AT       C  t       gc AT        Cg        gc TG        At        gt                         tttttacgcacaaacagtagtgaagagcgaaaatttcgcctttcgaattcactcacgttaggagaacaccATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [S] COG2326 Uncharacterized conserved protein ... can be seen here     ..................................................................................................................