Gene putatively regulated by attenuation in C_diphtheriae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:140 nt.     Distance to run of Ts=0 nt.   Size=29 nt.     Delta G=-12.10 kcal/mol
Antiterminator: Size=25 nt.     Delta G= -9.90 kcal/mol
Anti-antiterminator:   Size=54 nt.     Delta G=-14.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGGAGTCCAATAGTGCGAATCTTGCGGCGTAGAACATttaagagagtctacaagccacctcccctccgtggag
aatggatgactgagtgctcgttgaaggcgacagctgccaccgccacggctgcgggggtaagaaaaatcgactcctaccccctttttattaacccattctt
gagataatgcacgttttggatggaaactcactagcattgtgggggtatgtaagcgcgtaccactgccctacgcatgcttcgatgtactccccctttgtaa
aaccgacataaggaacacacgattctcATG

    DIP0892


Gene: DIP0892     GI: 38233488     BI number: DIP0892     GOG: -------     Description: Putative glyceraldehyde-3-phosphate dehydrogenas


  t
t  g
g  a
c  a
 tg
 cg
 gc
 tg
g  a
a  |
 gc
 ta
 cg
a  c
g  t                  t
t  g                a  c
a  |        g       a  g
 gc       c  g      a  a
 gc       a  c      a  c
 ta       c  t       at
a  c       cg        gc
a  c       gc       a  c
g  g       cg        at
a  |       cg        ta
 gc       a  g       gc
 gc        cg        gc
 ta        cg        gc
 gc        gt        gc
 cg        ta        gc
                        tttttattaacccattcttgagataatgcacgttttggatggaaactcactagcattgtgggggtatgtaagcgcgtaccactgccctacgcatgcttcgatgtactccccctttgtaaaaccgacataaggaacacacgattctcATG


    ..................................................................................................................