                                                                        Gene putatively regulated by attenuation in C_diphtheriae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:163 nt.     Distance to run of Ts=0 nt.   Size=34 nt.     Delta G=-15.90 kcal/mol
Antiterminator: Size=24 nt.     Delta G= -9.80 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
The sequences of the antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CAGCTGTGCGGTAATGCTCATaggctcggactgtaacgtttttcagaatttgttcagcagaaaaattccacatcccgcctttcga
cgtttccccacgggggagagttatccacaattacggctcttccccctttttattccccacgggctgcccatttctgggataatagacgcttttcgtttcc
ccacggggaggtgtgtcagacttagaccatgggattttttagtgatgttgtcgctcgtattcgtggtgttggccaatcgggtttgtcgggggctgatcct
gtggattgggttgttGTG

    DIP0897 --- DIP0896 --- DIP0895 Gene: DIP0897     GI: 38233493     BI number: DIP0897     GOG: COG0193     Description: Putative peptidyl tRNA hydrolase Gene: DIP0896     GI: 38233492     BI number: DIP0896     GOG: -------     Description: Putative oxydoreductase Gene: DIP0895     GI: 38233491     BI number: DIP0895     GOG: COG4108     Description: Putative peptide chain release factor            ca           a  a           c  t           c  t   c       t  a a  g      a  c cg        tg cg        tg cg        gc cg        at ta        gc tg        at ta        gt g  |       gc cg        gc at        gc gt        gc             ctttttattccccacgggctgcccatttctgggataatagacgcttttcgtttccccacggggaggtgtgtcagacttagaccatgggattttttagtgatgttgtcgctcgtattcgtggtgttggccaatcgggtttgtcgggggctgatcctgtggattgggttgttGTG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [J] COG0193 Peptidyl-tRNA hydrolase ... can be seen here [J] COG4108 Peptide chain release factor RF-3 ... can be seen here     ..................................................................................................................