Gene putatively regulated by attenuation in C_diphtheriae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:70 nt.     Distance to run of Ts=0 nt.   Size=31 nt.     Delta G=-22.80 kcal/mol
Antiterminator: Size=75 nt.     Delta G=-13.73 kcal/mol
Anti-antiterminator:   Size=45 nt.     Delta G= -8.10 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

CGCGAACGCCTCTCCCAGTGCGGCGCCAAGGAAGTCATCACCACCGACACTCTGCCAC
AGTCCACCGAAGGCTGGGACAACCTCACCGTCTTGTCCATCGCACCACTGCTGGCAAA
GACCATCCACGAAATTTTCGAAAACGGCTCTGTGACCACCCTCTTCGAGGGCCAAGCT
TAAcctctcacggaacacacaatcccgcgcgcgagcacctcgcacgcgggatttttctcactccacccacccatcatgagacaataaacaactgcaca
gtttccccacgggaaggagaaccccaccATG

    DIP0902


Gene: DIP0902     GI: 38233498     BI number: DIP0902     GOG: -------     Description: Putative hydrolas


            T
          T  C
           CG
           TA
           CG
           CG
           CG
          |  C
          |  C
          |  A
          |  A
          |  G
          |  C
          |  T
          |  T
          |  A
          |  A
          |  c
          A  c
          C  t
          C  c
           At
           Gc
           Ta
  T        Gc
A  T       Tg
 AT        Cg
 AT        Ta
 GC       |  a
 CG       |  c
A  A      |  a
C  A      |  c
C  A      |  a        a
T  A      |  c      c  c
A  C      |  a       gc
 CG       |  a       at
 CG       |  t       gc
|  C      C  c       cg
 AT        Gc        gc
 GC        Gc       c  a
 AT        Cg        gc
A  G      A  c       cg
 AT       A  g       gc
 CG       A  c       cg
|  A      A  g       cg
 GC        Gc        cg
 GC        Cg        ta
 TA        Ta        at
                        ttttctcactccacccacccatcatgagacaataaacaactgcacagtttccccacgggaaggagaaccccaccATG


    ..................................................................................................................