                                                                        Gene putatively regulated by attenuation in C_diphtheriae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:72 nt.     Distance to run of Ts=0 nt.   Size=39 nt.     Delta G=-25.60 kcal/mol
Antiterminator: Size=21 nt.     Delta G= -7.30 kcal/mol
Anti-antiterminator:   Size=34 nt.     Delta G= -4.50 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GCAGCGAAGGTGGCAAAGACCGCGCTAAAGGAAGGCAAGACCATCCGCCAGACTGTCA
TCGACTTGGGCTTTGTTGATGGCGAAAAGCTCACCGAGGAAGAGCTGGACAAGCGCCT
CAACGTTCTCGCAATGGCCAACACCGATCGCGACAAGTAAgtctttaacctgccgcatctgacaacagag
tgcgcctcctagtcaccttcagaccgggaggcgcattttcttttacctgcagttttgtagacacataaactatctttttgcgctcagtatacttttgcac
taggtttacctactGTG

    DIP0937 --- DIP0936 Gene: DIP0937     GI: 38233533     BI number: DIP0937     GOG: -------     Description: Putative tetR family transcriptional regulator Gene: DIP0936     GI: 38233532     BI number: DIP0936     GOG: -------     Description: Putative drug transport membrane protei                       t                     c  t   c                 c  c t  t                a  a g  t                 cg A  t                 ta A  a                 gc Ta                 a  c Gc                 t  g A  c       ca        cg At       a  a       cg Cg        gc        ta A  c       ta        cg Gc        cg        cg Cg        ta        gc Gc       |  g       cg C  |       at        gc Ta        cg        ta At        gc        gt Gc        cg        at                         ttcttttacctgcagttttgtagacacataaactatctttttgcgctcagtatacttttgcactaggtttacctactGTG     ..................................................................................................................