                                                                        Gene putatively regulated by attenuation in C_diphtheriae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:173 nt.     Distance to run of Ts=0 nt.   Size=24 nt.     Delta G= -6.20 kcal/mol
Antiterminator: Size=48 nt.     Delta G=-10.60 kcal/mol
Anti-antiterminator:   Size=27 nt.     Delta G= -9.70 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

TCACCAACGAGCCTTTGGCAATGCGCCAGATGATGGGGAGCTCTCGGGCGGGGGTAAC
GCCGCGAACGTATTGCGGAGTCACGGCTGTGTCATCGACAACTACGCCTGCTGCTTTG
GCGCTGGTTTTTGCCGCTGCTGCAGCAACATCGTCGACGCTTGCTGATGCCGTTCGTG
CAATTAATGCAACATCGTCTAAAAGGGCTGCTAAGCCACCGGCCATgggaaacctcaatttcgctt
tgtgacatggtcaacttttactcctagtctacgtcgcaggactgctctattgtcggtggcATG

    DIP0950 Gene: DIP0950     GI: 38233546     BI number: DIP0950     GOG: COG1893     Description: Putative oxidoreductas            GC           G  T            CG            AT            CG           T  T           G  C           A  A            GT            GC   T        CG A  T      |  A T  G       GC         G GC        TA       T  C CG        TA       C  T |  G      |  C      G  T |  A       AT       T  T A  G       TA        CG AT        GC        CG GC        CG        GC C  A      A  C       CG GC       A  C      |  C CG        GT        AT CG        CG        TG GC        GC        CG                         TTTTTGCCGCTGCTGCAGCAACATCGTCGACGCTTGCTGATGCCGTTCGTGCAATTAATGCAACATCGTCTAAAAGGGCTGCTAAGCCACCGGCCATgggaaacctcaatttcgctttgtgacatggtcaacttttactcctagtctacgtcgcaggactgctctattgtcggtggcATG                                                                         Orthologous genes that have a predicted attenuator, grouped in COG families [H] COG1893 Ketopantoate reductase ... can be seen here     ..................................................................................................................