                                                                        Gene putatively regulated by attenuation in C_diphtheriae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:190 nt.     Distance to run of Ts=3 nt.   Size=28 nt.     Delta G=-21.50 kcal/mol
Antiterminator: Size=47 nt.     Delta G= -9.20 kcal/mol
Anti-antiterminator:   Size=31 nt.     Delta G= -9.60 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

tatgtttttgtcaagctgcgggctggctgtgtgtggtcaaaactgtgggggtgctttgtcgtatgactaaggggccggtgagtgtgaactcatcggcctg
cagtttttactttatgccgctacagcgcgggcggggtgatgacaatgctcctttaactcatgtgataatcatatccattatcgattagcttcaagtttcc
taaggtcgaactacctagttgccgcattactggcgtcaactaccctcatatcgcctatttcagcacatgcagaaggttttttgagactcgtctcgacggt
GTG

    DIP0960 --- DIP0961 --- DIP0962 --- DIP0963 Gene: DIP0960     GI: 38233556     BI number: DIP0960     GOG: -------     Description: Hypothetical protein Gene: DIP0961     GI: 38233557     BI number: DIP0961     GOG: -------     Description: Putative ABC transport system ATP-binding protein Gene: DIP0962     GI: 38233558     BI number: DIP0962     GOG: -------     Description: Putative membrane protein Gene: DIP0963     GI: 38233559     BI number: DIP0963     GOG: -------     Description: Putative membrane protei            ta           g  t            cg            ta            gc           |  t            ta            ta            tg            cg           g  g   c        tg G  a       gc T  a       gc        tg G  a      g  |      g  a ta       g  |       ta gc       g  |       gc gt       t  |       at cg       g  |       gc at        tg        ta g  g       cg        gt cg        at        gc tg       |  g       cg cg       a  a       cg tg       a  g       gc gt        at        gc cg        cg        gt                         gcagtttttactttatgccgctacagcgcgggcggggtgatgacaatgctcctttaactcatgtgataatcatatccattatcgattagcttcaagtttcctaaggtcgaactacctagttgccgcattactggcgtcaactaccctcatatcgcctatttcagcacatgcagaaggttttttgagactcgtctcgacggtGTG     ..................................................................................................................