Gene putatively regulated by attenuation in C_diphtheriae

                                                                        Characteristics of the secondary structures
Terminator:    Distance to gene:141 nt.     Distance to run of Ts=0 nt.   Size=15 nt.     Delta G= -8.00 kcal/mol
Antiterminator: Size=32 nt.     Delta G=-13.30 kcal/mol
Anti-antiterminator:   Size=48 nt.     Delta G=-18.20 kcal/mol

                                                                        Nomenclature/Definitions
Bases shared by the antitermination and termination structures are shown in red
Bases shared by the anti-antitermination and antitermination structures are shown in green
The sequences of the anti-antiterminator, antiterminator and terminator structures are underlined
Coding regions are in CAPS, non-coding regions are in lower case

GTCGACGTGCGCTCCTCATGCGCGCGCTTATCGACGCCGGCTTTACCGTCGAACACTC
CGAAGCCGGTCTGTACCTGTGGGCCACCCGCGGCGAAAACTGCCGTGCCACCGTCGAC
TGGTTTGCCTCTCATGGCATCTTGGTCGCCCCCGGCGACTTTTATGGCCCCGACGCCC
ACAACTTCGTGCGCGTCGCTCTGACCACCACTGATGACAATGCCGAAAAAGTGGCGGC
CCGCCTCCAAAAGGGGAATTAGttaccagaaggtcgtcctccacgatgtcgtccccgaaggcgagtacGTG

    DIP0975 --- DIP0976


Gene: DIP0975     GI: 38233570     BI number: DIP0975     GOG: -------     Description: Putative RNA pseudouridylate synthase family protein
Gene: DIP0976     GI: 38233571     BI number: DIP0976     GOG: -------     Description: Putative membrane protei


  A
A  A
A  C
 GT
 CG
 GC
 GC
 CG
 GT
 CG        TC
|  C      C  A
C  C      T  T
C  A       CG
A  C       CG
C  C       GC
 CG        TA
 GT       T  T
 GC       T  C        C
G  G       GT       C  C
 TA        GT        CG
 GC        TG        CG
T  T       CG        GC
 CG        AT        CG
 CG        GC        TA
 AT        CG        GC
                        TTTTATGGCCCCGACGCCCACAACTTCGTGCGCGTCGCTCTGACCACCACTGATGACAATGCCGAAAAAGTGGCGGCCCGCCTCCAAAAGGGGAATTAGttaccagaaggtcgtcctccacgatgtcgtccccgaaggcgagtacGTG


    ..................................................................................................................